\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1126273958:

Variant ID: vg1126273958 (JBrowse)Variation Type: SNP
Chromosome: chr11Position: 26273958
Reference Allele: AAlternative Allele: G
Primary Allele: ASecondary Allele: G

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.99, G: 0.02, others allele: 0.00, population size: 90. )

Flanking Sequence (100 bp) in Reference Genome:


GTACATGCAGCTGGCATTCCTGTCTGGAAGGATCGATGTTTCAGCCTGAAAGACGTCTGAACTCTGAATTTGAAGTGTTGAACAGTTTCAGAAACATGTT[A/G]
ACCTAGCTAGCAAGAGAGTGTGAAACAACTTCAGAATTGCAAAAACTGTAATGCATGATCGGATTTCAGAATCATCCAAGGATTTATAGCAGAATGTTTT

Reverse complement sequence

AAAACATTCTGCTATAAATCCTTGGATGATTCTGAAATCCGATCATGCATTACAGTTTTTGCAATTCTGAAGTTGTTTCACACTCTCTTGCTAGCTAGGT[T/C]
AACATGTTTCTGAAACTGTTCAACACTTCAAATTCAGAGTTCAGACGTCTTTCAGGCTGAAACATCGATCCTTCCAGACAGGAATGCCAGCTGCATGTAC

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 55.20% 44.50% 0.08% 0.21% NA
All Indica  2759 44.30% 55.30% 0.11% 0.29% NA
All Japonica  1512 75.10% 24.90% 0.07% 0.00% NA
Aus  269 40.50% 59.10% 0.00% 0.37% NA
Indica I  595 35.80% 63.70% 0.17% 0.34% NA
Indica II  465 66.50% 33.30% 0.00% 0.22% NA
Indica III  913 27.30% 72.40% 0.11% 0.22% NA
Indica Intermediate  786 57.50% 42.00% 0.13% 0.38% NA
Temperate Japonica  767 93.10% 6.90% 0.00% 0.00% NA
Tropical Japonica  504 42.50% 57.30% 0.20% 0.00% NA
Japonica Intermediate  241 85.90% 14.10% 0.00% 0.00% NA
VI/Aromatic  96 97.90% 2.10% 0.00% 0.00% NA
Intermediate  90 54.40% 44.40% 0.00% 1.11% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1126273958 A -> DEL N N silent_mutation Average:49.56; most accessible tissue: Callus, score: 80.338 N N N N
vg1126273958 A -> G LOC_Os11g43530.1 upstream_gene_variant ; 1852.0bp to feature; MODIFIER silent_mutation Average:49.56; most accessible tissue: Callus, score: 80.338 N N N N
vg1126273958 A -> G LOC_Os11g43520.1 downstream_gene_variant ; 3370.0bp to feature; MODIFIER silent_mutation Average:49.56; most accessible tissue: Callus, score: 80.338 N N N N
vg1126273958 A -> G LOC_Os11g43520-LOC_Os11g43530 intergenic_region ; MODIFIER silent_mutation Average:49.56; most accessible tissue: Callus, score: 80.338 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1126273958 NA 5.51E-06 mr1078 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1126273958 NA 5.73E-09 mr1090 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1126273958 NA 8.47E-08 mr1121 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1126273958 NA 1.14E-06 mr1124 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1126273958 6.20E-08 6.96E-12 mr1191 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1126273958 3.59E-06 8.08E-09 mr1211 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1126273958 NA 1.58E-09 mr1251 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1126273958 NA 1.46E-06 mr1448 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1126273958 NA 3.28E-12 mr1644 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1126273958 4.10E-08 5.12E-14 mr1644 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1126273958 NA 8.42E-13 mr1191_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1126273958 NA 1.95E-12 mr1191_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251