\
| Variant ID: vg1126198147 (JBrowse) | Variation Type: SNP |
| Chromosome: chr11 | Position: 26198147 |
| Reference Allele: C | Alternative Allele: T |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele: Not determined.
TATATAGAGTAGAGGGACCAAATTAAAGTGGTTGATAGACTGTAGCGTGCAAATTAAGGCTTAGCCTTTGTGGATGCTGAACAAGATGGTAGAGCTTATA[C/T]
ACGTGTACAGATCGAACCAGATGCAAATGCTACAGCACCGGCTAGCAAGGAAAACAAAGCATAGGCGGGAGGTCAGAATATTTACTTTTCTTTTCTTCTT
AAGAAGAAAAGAAAAGTAAATATTCTGACCTCCCGCCTATGCTTTGTTTTCCTTGCTAGCCGGTGCTGTAGCATTTGCATCTGGTTCGATCTGTACACGT[G/A]
TATAAGCTCTACCATCTTGTTCAGCATCCACAAAGGCTAAGCCTTAATTTGCACGCTACAGTCTATCAACCACTTTAATTTGGTCCCTCTACTCTATATA
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 25.80% | 11.90% | 3.32% | 58.95% | NA |
| All Indica | 2759 | 18.90% | 15.50% | 3.12% | 62.49% | NA |
| All Japonica | 1512 | 41.80% | 2.40% | 3.90% | 51.85% | NA |
| Aus | 269 | 14.10% | 2.60% | 1.86% | 81.41% | NA |
| Indica I | 595 | 5.50% | 2.00% | 1.85% | 90.59% | NA |
| Indica II | 465 | 15.30% | 40.00% | 1.94% | 42.80% | NA |
| Indica III | 913 | 25.10% | 10.60% | 4.05% | 60.24% | NA |
| Indica Intermediate | 786 | 24.00% | 16.80% | 3.69% | 55.47% | NA |
| Temperate Japonica | 767 | 35.30% | 3.00% | 4.69% | 56.98% | NA |
| Tropical Japonica | 504 | 59.30% | 1.00% | 2.38% | 37.30% | NA |
| Japonica Intermediate | 241 | 25.70% | 3.70% | 4.56% | 65.98% | NA |
| VI/Aromatic | 96 | 0.00% | 80.20% | 5.21% | 14.58% | NA |
| Intermediate | 90 | 32.20% | 15.60% | 2.22% | 50.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1126198147 | C -> T | LOC_Os11g43390.1 | upstream_gene_variant ; 131.0bp to feature; MODIFIER | silent_mutation | Average:28.627; most accessible tissue: Minghui63 root, score: 71.702 | N | N | N | N |
| vg1126198147 | C -> T | LOC_Os11g43400.1 | upstream_gene_variant ; 2490.0bp to feature; MODIFIER | silent_mutation | Average:28.627; most accessible tissue: Minghui63 root, score: 71.702 | N | N | N | N |
| vg1126198147 | C -> T | LOC_Os11g43390-LOC_Os11g43400 | intergenic_region ; MODIFIER | silent_mutation | Average:28.627; most accessible tissue: Minghui63 root, score: 71.702 | N | N | N | N |
| vg1126198147 | C -> DEL | N | N | silent_mutation | Average:28.627; most accessible tissue: Minghui63 root, score: 71.702 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1126198147 | NA | 2.24E-07 | Grain_thickness | Ind_All | Not | Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652 |
| vg1126198147 | NA | 9.33E-06 | mr1382 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1126198147 | NA | 1.23E-06 | mr1696 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |