\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1126094764:

Variant ID: vg1126094764 (JBrowse)Variation Type: SNP
Chromosome: chr11Position: 26094764
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.67, C: 0.33, others allele: 0.00, population size: 54. )

Flanking Sequence (100 bp) in Reference Genome:


TATGTTAAGAAAAAAAGCCCTCGGACCCACGTTACAGCCCATCGTAGCATGCATATAGCAATCATAATAGATATCGTTCTATCTCCACGTATCCATCTCA[C/T]
ATTCGTATCCTAACAGACGAGAAGATGAAGAGGACTTCATCGCGACAAGCGATGAGGACTCTCTCTGCGAGGCAGTGATGGGGGTGCGTTCCACTCCAGT

Reverse complement sequence

ACTGGAGTGGAACGCACCCCCATCACTGCCTCGCAGAGAGAGTCCTCATCGCTTGTCGCGATGAAGTCCTCTTCATCTTCTCGTCTGTTAGGATACGAAT[G/A]
TGAGATGGATACGTGGAGATAGAACGATATCTATTATGATTGCTATATGCATGCTACGATGGGCTGTAACGTGGGTCCGAGGGCTTTTTTTCTTAACATA

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 24.40% 23.60% 3.00% 49.09% NA
All Indica  2759 17.10% 14.40% 2.03% 66.47% NA
All Japonica  1512 38.10% 42.90% 5.42% 13.62% NA
Aus  269 25.30% 11.50% 1.12% 62.08% NA
Indica I  595 5.90% 25.20% 2.86% 66.05% NA
Indica II  465 31.20% 7.30% 3.01% 58.49% NA
Indica III  913 15.80% 6.10% 0.55% 77.55% NA
Indica Intermediate  786 19.00% 19.80% 2.54% 58.65% NA
Temperate Japonica  767 36.10% 52.90% 7.95% 3.00% NA
Tropical Japonica  504 49.40% 26.00% 1.59% 23.02% NA
Japonica Intermediate  241 20.70% 46.10% 5.39% 27.80% NA
VI/Aromatic  96 3.10% 18.80% 1.04% 77.08% NA
Intermediate  90 34.40% 22.20% 0.00% 43.33% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1126094764 C -> T LOC_Os11g43250.1 upstream_gene_variant ; 3481.0bp to feature; MODIFIER silent_mutation Average:33.798; most accessible tissue: Callus, score: 73.582 N N N N
vg1126094764 C -> T LOC_Os11g43260.1 downstream_gene_variant ; 3671.0bp to feature; MODIFIER silent_mutation Average:33.798; most accessible tissue: Callus, score: 73.582 N N N N
vg1126094764 C -> T LOC_Os11g43250-LOC_Os11g43260 intergenic_region ; MODIFIER silent_mutation Average:33.798; most accessible tissue: Callus, score: 73.582 N N N N
vg1126094764 C -> DEL N N silent_mutation Average:33.798; most accessible tissue: Callus, score: 73.582 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1126094764 7.11E-06 7.11E-06 mr1276 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1126094764 1.02E-06 6.87E-08 mr1238_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1126094764 NA 6.38E-07 mr1332_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1126094764 NA 8.80E-07 mr1332_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1126094764 2.21E-06 2.83E-07 mr1484_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1126094764 NA 2.08E-06 mr1609_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1126094764 1.73E-06 2.11E-07 mr1841_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1126094764 4.68E-06 2.85E-07 mr1900_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1126094764 NA 5.34E-06 mr1944_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1126094764 2.00E-06 2.00E-06 mr1945_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251