Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923).

Detailed information for vg1126094764:

Variant ID: vg1126094764 (JBrowse)	Variation Type: SNP
Chromosome: chr11	Position: 26094764
Reference Allele: C	Alternative Allele: T
Primary Allele: C	Secondary Allele: T

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.67, C: 0.33, others allele: 0.00, population size: 54. )

Flanking Sequence (100 bp) in Reference Genome:

TATGTTAAGAAAAAAAGCCCTCGGACCCACGTTACAGCCCATCGTAGCATGCATATAGCAATCATAATAGATATCGTTCTATCTCCACGTATCCATCTCA[C/T]
ATTCGTATCCTAACAGACGAGAAGATGAAGAGGACTTCATCGCGACAAGCGATGAGGACTCTCTCTGCGAGGCAGTGATGGGGGTGCGTTCCACTCCAGT

Reverse complement sequence

ACTGGAGTGGAACGCACCCCCATCACTGCCTCGCAGAGAGAGTCCTCATCGCTTGTCGCGATGAAGTCCTCTTCATCTTCTCGTCTGTTAGGATACGAAT[G/A]
TGAGATGGATACGTGGAGATAGAACGATATCTATTATGATTGCTATATGCATGCTACGATGGGCTGTAACGTGGGTCCGAGGGCTTTTTTTCTTAACATA

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	24.40%	23.60%	3.00%	49.09%	NA
All Indica	2759	17.10%	14.40%	2.03%	66.47%	NA
All Japonica	1512	38.10%	42.90%	5.42%	13.62%	NA
Aus	269	25.30%	11.50%	1.12%	62.08%	NA
Indica I	595	5.90%	25.20%	2.86%	66.05%	NA
Indica II	465	31.20%	7.30%	3.01%	58.49%	NA
Indica III	913	15.80%	6.10%	0.55%	77.55%	NA
Indica Intermediate	786	19.00%	19.80%	2.54%	58.65%	NA
Temperate Japonica	767	36.10%	52.90%	7.95%	3.00%	NA
Tropical Japonica	504	49.40%	26.00%	1.59%	23.02%	NA
Japonica Intermediate	241	20.70%	46.10%	5.39%	27.80%	NA
VI/Aromatic	96	3.10%	18.80%	1.04%	77.08%	NA
Intermediate	90	34.40%	22.20%	0.00%	43.33%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1126094764	C -> T	LOC_Os11g43250.1	upstream_gene_variant ; 3481.0bp to feature; MODIFIER	silent_mutation	Average:33.798; most accessible tissue: Callus, score: 73.582	N	N	N	N
vg1126094764	C -> T	LOC_Os11g43260.1	downstream_gene_variant ; 3671.0bp to feature; MODIFIER	silent_mutation	Average:33.798; most accessible tissue: Callus, score: 73.582	N	N	N	N
vg1126094764	C -> T	LOC_Os11g43250-LOC_Os11g43260	intergenic_region ; MODIFIER	silent_mutation	Average:33.798; most accessible tissue: Callus, score: 73.582	N	N	N	N
vg1126094764	C -> DEL	N	N	silent_mutation	Average:33.798; most accessible tissue: Callus, score: 73.582	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1126094764	7.11E-06	7.11E-06	mr1276	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1126094764	1.02E-06	6.87E-08	mr1238_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1126094764	NA	6.38E-07	mr1332_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1126094764	NA	8.80E-07	mr1332_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1126094764	2.21E-06	2.83E-07	mr1484_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1126094764	NA	2.08E-06	mr1609_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1126094764	1.73E-06	2.11E-07	mr1841_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1126094764	4.68E-06	2.85E-07	mr1900_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1126094764	NA	5.34E-06	mr1944_2	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1126094764	2.00E-06	2.00E-06	mr1945_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251