\
| Variant ID: vg1126094764 (JBrowse) | Variation Type: SNP |
| Chromosome: chr11 | Position: 26094764 |
| Reference Allele: C | Alternative Allele: T |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.67, C: 0.33, others allele: 0.00, population size: 54. )
TATGTTAAGAAAAAAAGCCCTCGGACCCACGTTACAGCCCATCGTAGCATGCATATAGCAATCATAATAGATATCGTTCTATCTCCACGTATCCATCTCA[C/T]
ATTCGTATCCTAACAGACGAGAAGATGAAGAGGACTTCATCGCGACAAGCGATGAGGACTCTCTCTGCGAGGCAGTGATGGGGGTGCGTTCCACTCCAGT
ACTGGAGTGGAACGCACCCCCATCACTGCCTCGCAGAGAGAGTCCTCATCGCTTGTCGCGATGAAGTCCTCTTCATCTTCTCGTCTGTTAGGATACGAAT[G/A]
TGAGATGGATACGTGGAGATAGAACGATATCTATTATGATTGCTATATGCATGCTACGATGGGCTGTAACGTGGGTCCGAGGGCTTTTTTTCTTAACATA
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 24.40% | 23.60% | 3.00% | 49.09% | NA |
| All Indica | 2759 | 17.10% | 14.40% | 2.03% | 66.47% | NA |
| All Japonica | 1512 | 38.10% | 42.90% | 5.42% | 13.62% | NA |
| Aus | 269 | 25.30% | 11.50% | 1.12% | 62.08% | NA |
| Indica I | 595 | 5.90% | 25.20% | 2.86% | 66.05% | NA |
| Indica II | 465 | 31.20% | 7.30% | 3.01% | 58.49% | NA |
| Indica III | 913 | 15.80% | 6.10% | 0.55% | 77.55% | NA |
| Indica Intermediate | 786 | 19.00% | 19.80% | 2.54% | 58.65% | NA |
| Temperate Japonica | 767 | 36.10% | 52.90% | 7.95% | 3.00% | NA |
| Tropical Japonica | 504 | 49.40% | 26.00% | 1.59% | 23.02% | NA |
| Japonica Intermediate | 241 | 20.70% | 46.10% | 5.39% | 27.80% | NA |
| VI/Aromatic | 96 | 3.10% | 18.80% | 1.04% | 77.08% | NA |
| Intermediate | 90 | 34.40% | 22.20% | 0.00% | 43.33% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1126094764 | C -> T | LOC_Os11g43250.1 | upstream_gene_variant ; 3481.0bp to feature; MODIFIER | silent_mutation | Average:33.798; most accessible tissue: Callus, score: 73.582 | N | N | N | N |
| vg1126094764 | C -> T | LOC_Os11g43260.1 | downstream_gene_variant ; 3671.0bp to feature; MODIFIER | silent_mutation | Average:33.798; most accessible tissue: Callus, score: 73.582 | N | N | N | N |
| vg1126094764 | C -> T | LOC_Os11g43250-LOC_Os11g43260 | intergenic_region ; MODIFIER | silent_mutation | Average:33.798; most accessible tissue: Callus, score: 73.582 | N | N | N | N |
| vg1126094764 | C -> DEL | N | N | silent_mutation | Average:33.798; most accessible tissue: Callus, score: 73.582 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1126094764 | 7.11E-06 | 7.11E-06 | mr1276 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1126094764 | 1.02E-06 | 6.87E-08 | mr1238_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1126094764 | NA | 6.38E-07 | mr1332_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1126094764 | NA | 8.80E-07 | mr1332_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1126094764 | 2.21E-06 | 2.83E-07 | mr1484_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1126094764 | NA | 2.08E-06 | mr1609_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1126094764 | 1.73E-06 | 2.11E-07 | mr1841_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1126094764 | 4.68E-06 | 2.85E-07 | mr1900_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1126094764 | NA | 5.34E-06 | mr1944_2 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1126094764 | 2.00E-06 | 2.00E-06 | mr1945_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |