\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1126030224:

Variant ID: vg1126030224 (JBrowse)Variation Type: SNP
Chromosome: chr11Position: 26030224
Reference Allele: AAlternative Allele: T
Primary Allele: ASecondary Allele: T

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.84, A: 0.17, others allele: 0.00, population size: 245. )

Flanking Sequence (100 bp) in Reference Genome:


GAGAACTCGAATATCTTCTTAGCATTGTTGCACAACGATGATTCTTCTGAGACCAGTTGGGTGCTGTCATTGCTTTTGTCAGGCTCAGGACTAGCCTTGG[A/T]
AGCATTACTGGCTAGCGATTTTTGTGGAACCAGGGTTTTATACAACTCGCGCAGATCATTGTTGCTCCTATTGGGTTCAGCATACAAAGCATGAGCAAAC

Reverse complement sequence

GTTTGCTCATGCTTTGTATGCTGAACCCAATAGGAGCAACAATGATCTGCGCGAGTTGTATAAAACCCTGGTTCCACAAAAATCGCTAGCCAGTAATGCT[T/A]
CCAAGGCTAGTCCTGAGCCTGACAAAAGCAATGACAGCACCCAACTGGTCTCAGAAGAATCATCGTTGTGCAACAATGCTAAGAAGATATTCGAGTTCTC

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 62.20% 34.70% 0.21% 2.88% NA
All Indica  2759 45.90% 48.90% 0.33% 4.89% NA
All Japonica  1512 93.20% 6.80% 0.00% 0.00% NA
Aus  269 43.10% 56.50% 0.37% 0.00% NA
Indica I  595 49.10% 50.30% 0.67% 0.00% NA
Indica II  465 54.80% 44.50% 0.22% 0.43% NA
Indica III  913 33.70% 53.10% 0.00% 13.14% NA
Indica Intermediate  786 52.40% 45.40% 0.51% 1.65% NA
Temperate Japonica  767 96.60% 3.40% 0.00% 0.00% NA
Tropical Japonica  504 87.90% 12.10% 0.00% 0.00% NA
Japonica Intermediate  241 93.40% 6.60% 0.00% 0.00% NA
VI/Aromatic  96 96.90% 3.10% 0.00% 0.00% NA
Intermediate  90 58.90% 40.00% 0.00% 1.11% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1126030224 A -> T LOC_Os11g43140.1 missense_variant ; p.Ser690Thr; MODERATE nonsynonymous_codon ; S690T Average:73.326; most accessible tissue: Callus, score: 95.355 unknown unknown TOLERATED 1.00
vg1126030224 A -> DEL LOC_Os11g43140.1 N frameshift_variant Average:73.326; most accessible tissue: Callus, score: 95.355 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg1126030224 A T 0.04 0.02 0.02 0.03 0.02 0.02

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1126030224 2.62E-07 9.97E-14 mr1191 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1126030224 1.40E-08 1.37E-11 mr1191 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1126030224 NA 1.19E-06 mr1561 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1126030224 3.99E-08 2.35E-14 mr1644 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1126030224 2.30E-08 9.73E-12 mr1644 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1126030224 1.31E-09 6.43E-23 mr1191_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1126030224 1.04E-09 4.02E-17 mr1191_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251