Variant ID: vg1125964996 (JBrowse) | Variation Type: SNP |
Chromosome: chr11 | Position: 25964996 |
Reference Allele: T | Alternative Allele: C |
Primary Allele: T | Secondary Allele: C |
Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.88, C: 0.13, others allele: 0.00, population size: 90. )
CAGGTTATAAGATGTTTTGACTTTGGTAAAAGTCAAATTACATCAAGTTTGACTAAGTTTATAGACAAATATAGTAATATTTATAATACGAAATTAGTTT[T/C]
ATTAAATCAATAATTGAATATATTTTTATAATAAATTTGTCTTGGGTTAAAAATGTTATTATTTTTTCTACAAACTTAGTCAAACTTAAAACAGTTTAAC
GTTAAACTGTTTTAAGTTTGACTAAGTTTGTAGAAAAAATAATAACATTTTTAACCCAAGACAAATTTATTATAAAAATATATTCAATTATTGATTTAAT[A/G]
AAACTAATTTCGTATTATAAATATTACTATATTTGTCTATAAACTTAGTCAAACTTGATGTAATTTGACTTTTACCAAAGTCAAAACATCTTATAACCTG
Populations | Population Size | Frequency of T(primary allele) | Frequency of C(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
---|---|---|---|---|---|---|
All | 4726 | 62.90% | 34.10% | 0.25% | 2.77% | NA |
All Indica | 2759 | 47.60% | 47.40% | 0.36% | 4.68% | NA |
All Japonica | 1512 | 93.30% | 6.70% | 0.00% | 0.00% | NA |
Aus | 269 | 37.20% | 62.50% | 0.37% | 0.00% | NA |
Indica I | 595 | 59.70% | 40.20% | 0.17% | 0.00% | NA |
Indica II | 465 | 39.60% | 60.00% | 0.22% | 0.22% | NA |
Indica III | 913 | 35.90% | 50.80% | 0.77% | 12.49% | NA |
Indica Intermediate | 786 | 56.70% | 41.30% | 0.13% | 1.78% | NA |
Temperate Japonica | 767 | 96.90% | 3.10% | 0.00% | 0.00% | NA |
Tropical Japonica | 504 | 87.70% | 12.30% | 0.00% | 0.00% | NA |
Japonica Intermediate | 241 | 93.40% | 6.60% | 0.00% | 0.00% | NA |
VI/Aromatic | 96 | 99.00% | 1.00% | 0.00% | 0.00% | NA |
Intermediate | 90 | 60.00% | 36.70% | 1.11% | 2.22% | NA |
Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
---|---|---|---|---|---|---|---|---|---|
vg1125964996 | T -> DEL | N | N | silent_mutation | Average:29.133; most accessible tissue: Minghui63 panicle, score: 66.554 | N | N | N | N |
vg1125964996 | T -> C | LOC_Os11g43040-LOC_Os11g43060 | intergenic_region ; MODIFIER | silent_mutation | Average:29.133; most accessible tissue: Minghui63 panicle, score: 66.554 | N | N | N | N |
Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
---|---|---|---|---|---|---|
vg1125964996 | 3.34E-10 | 6.54E-16 | mr1191 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg1125964996 | 1.40E-10 | 1.87E-11 | mr1191 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg1125964996 | 2.79E-13 | 5.89E-17 | mr1644 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg1125964996 | 8.83E-13 | 2.51E-12 | mr1644 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg1125964996 | 6.92E-14 | 1.27E-21 | mr1191_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg1125964996 | 6.40E-12 | 3.83E-13 | mr1191_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |