\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1125943983:

Variant ID: vg1125943983 (JBrowse)Variation Type: SNP
Chromosome: chr11Position: 25943983
Reference Allele: GAlternative Allele: A,C
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.96, C: 0.04, others allele: 0.00, population size: 97. )

Flanking Sequence (100 bp) in Reference Genome:


TTTAGTAAACTAACCTAAGGGTGCGTTTAGTTTACGCTAAAATTGGAAGATTGATTGAAATTGGAACGATGTGACGGAAAAATTGAAAGTTTGTGTGTAG[G/A,C]
AAGTTTTGATGTGATGAAAAAATTGGAAATTTGAAAAAAAAAAAGTTAGGAACTAAACCAGGCCTAACAATGATCAGAGCTTAGTGATAAGTCCCTATAT

Reverse complement sequence

ATATAGGGACTTATCACTAAGCTCTGATCATTGTTAGGCCTGGTTTAGTTCCTAACTTTTTTTTTTTCAAATTTCCAATTTTTTCATCACATCAAAACTT[C/T,G]
CTACACACAAACTTTCAATTTTTCCGTCACATCGTTCCAATTTCAATCAATCTTCCAATTTTAGCGTAAACTAAACGCACCCTTAGGTTAGTTTACTAAA

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 83.90% 10.90% 0.74% 2.48% C: 2.03%
All Indica  2759 80.30% 15.90% 0.80% 1.16% C: 1.81%
All Japonica  1512 89.50% 4.30% 0.46% 5.62% C: 0.13%
Aus  269 95.50% 1.90% 0.00% 0.00% C: 2.60%
Indica I  595 68.20% 29.90% 1.85% 0.00% NA
Indica II  465 65.60% 32.50% 0.86% 0.22% C: 0.86%
Indica III  913 91.80% 2.10% 0.55% 2.41% C: 3.18%
Indica Intermediate  786 84.70% 11.70% 0.25% 1.15% C: 2.16%
Temperate Japonica  767 82.30% 7.40% 0.78% 9.52% NA
Tropical Japonica  504 99.40% 0.40% 0.00% 0.00% C: 0.20%
Japonica Intermediate  241 91.70% 2.50% 0.41% 4.98% C: 0.41%
VI/Aromatic  96 62.50% 0.00% 2.08% 0.00% C: 35.42%
Intermediate  90 86.70% 5.60% 4.44% 0.00% C: 3.33%

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1125943983 G -> A LOC_Os11g43030.1 upstream_gene_variant ; 132.0bp to feature; MODIFIER silent_mutation Average:39.218; most accessible tissue: Minghui63 root, score: 62.438 N N N N
vg1125943983 G -> A LOC_Os11g43020-LOC_Os11g43030 intergenic_region ; MODIFIER silent_mutation Average:39.218; most accessible tissue: Minghui63 root, score: 62.438 N N N N
vg1125943983 G -> DEL N N silent_mutation Average:39.218; most accessible tissue: Minghui63 root, score: 62.438 N N N N
vg1125943983 G -> C LOC_Os11g43030.1 upstream_gene_variant ; 132.0bp to feature; MODIFIER silent_mutation Average:39.218; most accessible tissue: Minghui63 root, score: 62.438 N N N N
vg1125943983 G -> C LOC_Os11g43020-LOC_Os11g43030 intergenic_region ; MODIFIER silent_mutation Average:39.218; most accessible tissue: Minghui63 root, score: 62.438 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1125943983 4.86E-10 3.10E-14 mr1191 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125943983 1.89E-11 2.26E-12 mr1191 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125943983 NA 2.44E-06 mr1561 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125943983 5.01E-09 1.38E-12 mr1644 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125943983 8.43E-10 1.54E-10 mr1644 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125943983 3.65E-09 2.64E-11 mr1662 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125943983 NA 6.31E-07 mr1133_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125943983 3.77E-13 5.74E-22 mr1191_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125943983 3.36E-16 1.84E-18 mr1191_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125943983 NA 3.31E-07 mr1662_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125943983 4.88E-08 7.73E-12 mr1662_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125943983 NA 3.89E-06 mr1745_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251