\
| Variant ID: vg1125943983 (JBrowse) | Variation Type: SNP |
| Chromosome: chr11 | Position: 25943983 |
| Reference Allele: G | Alternative Allele: A,C |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.96, C: 0.04, others allele: 0.00, population size: 97. )
TTTAGTAAACTAACCTAAGGGTGCGTTTAGTTTACGCTAAAATTGGAAGATTGATTGAAATTGGAACGATGTGACGGAAAAATTGAAAGTTTGTGTGTAG[G/A,C]
AAGTTTTGATGTGATGAAAAAATTGGAAATTTGAAAAAAAAAAAGTTAGGAACTAAACCAGGCCTAACAATGATCAGAGCTTAGTGATAAGTCCCTATAT
ATATAGGGACTTATCACTAAGCTCTGATCATTGTTAGGCCTGGTTTAGTTCCTAACTTTTTTTTTTTCAAATTTCCAATTTTTTCATCACATCAAAACTT[C/T,G]
CTACACACAAACTTTCAATTTTTCCGTCACATCGTTCCAATTTCAATCAATCTTCCAATTTTAGCGTAAACTAAACGCACCCTTAGGTTAGTTTACTAAA
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 83.90% | 10.90% | 0.74% | 2.48% | C: 2.03% |
| All Indica | 2759 | 80.30% | 15.90% | 0.80% | 1.16% | C: 1.81% |
| All Japonica | 1512 | 89.50% | 4.30% | 0.46% | 5.62% | C: 0.13% |
| Aus | 269 | 95.50% | 1.90% | 0.00% | 0.00% | C: 2.60% |
| Indica I | 595 | 68.20% | 29.90% | 1.85% | 0.00% | NA |
| Indica II | 465 | 65.60% | 32.50% | 0.86% | 0.22% | C: 0.86% |
| Indica III | 913 | 91.80% | 2.10% | 0.55% | 2.41% | C: 3.18% |
| Indica Intermediate | 786 | 84.70% | 11.70% | 0.25% | 1.15% | C: 2.16% |
| Temperate Japonica | 767 | 82.30% | 7.40% | 0.78% | 9.52% | NA |
| Tropical Japonica | 504 | 99.40% | 0.40% | 0.00% | 0.00% | C: 0.20% |
| Japonica Intermediate | 241 | 91.70% | 2.50% | 0.41% | 4.98% | C: 0.41% |
| VI/Aromatic | 96 | 62.50% | 0.00% | 2.08% | 0.00% | C: 35.42% |
| Intermediate | 90 | 86.70% | 5.60% | 4.44% | 0.00% | C: 3.33% |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1125943983 | G -> A | LOC_Os11g43030.1 | upstream_gene_variant ; 132.0bp to feature; MODIFIER | silent_mutation | Average:39.218; most accessible tissue: Minghui63 root, score: 62.438 | N | N | N | N |
| vg1125943983 | G -> A | LOC_Os11g43020-LOC_Os11g43030 | intergenic_region ; MODIFIER | silent_mutation | Average:39.218; most accessible tissue: Minghui63 root, score: 62.438 | N | N | N | N |
| vg1125943983 | G -> DEL | N | N | silent_mutation | Average:39.218; most accessible tissue: Minghui63 root, score: 62.438 | N | N | N | N |
| vg1125943983 | G -> C | LOC_Os11g43030.1 | upstream_gene_variant ; 132.0bp to feature; MODIFIER | silent_mutation | Average:39.218; most accessible tissue: Minghui63 root, score: 62.438 | N | N | N | N |
| vg1125943983 | G -> C | LOC_Os11g43020-LOC_Os11g43030 | intergenic_region ; MODIFIER | silent_mutation | Average:39.218; most accessible tissue: Minghui63 root, score: 62.438 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1125943983 | 4.86E-10 | 3.10E-14 | mr1191 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1125943983 | 1.89E-11 | 2.26E-12 | mr1191 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1125943983 | NA | 2.44E-06 | mr1561 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1125943983 | 5.01E-09 | 1.38E-12 | mr1644 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1125943983 | 8.43E-10 | 1.54E-10 | mr1644 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1125943983 | 3.65E-09 | 2.64E-11 | mr1662 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1125943983 | NA | 6.31E-07 | mr1133_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1125943983 | 3.77E-13 | 5.74E-22 | mr1191_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1125943983 | 3.36E-16 | 1.84E-18 | mr1191_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1125943983 | NA | 3.31E-07 | mr1662_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1125943983 | 4.88E-08 | 7.73E-12 | mr1662_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1125943983 | NA | 3.89E-06 | mr1745_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |