Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1125888962:

Variant ID: vg1125888962 (JBrowse)Variation Type: SNP
Chromosome: chr11Position: 25888962
Reference Allele: GAlternative Allele: A
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 1.00, others allele: 0.00, population size: 115. )

Flanking Sequence (100 bp) in Reference Genome:


AAAAATTAAAGCCATTACTATAAAAATCCACATTGCATGGACATATTATTTTTTAGATAAAATGAATCTTTCGCTAAGTAATAAAATTAAATAAAATTTT[G/A]
CGGTGCTTAAAAAATACCTAGAGATACTAAAATTTTACACCAAAACTTTTGGTATCTCAAAGTATCTAGTACTTAAAAATACCAAGATTTACACTAGAAA

Reverse complement sequence

TTTCTAGTGTAAATCTTGGTATTTTTAAGTACTAGATACTTTGAGATACCAAAAGTTTTGGTGTAAAATTTTAGTATCTCTAGGTATTTTTTAAGCACCG[C/T]
AAAATTTTATTTAATTTTATTACTTAGCGAAAGATTCATTTTATCTAAAAAATAATATGTCCATGCAATGTGGATTTTTATAGTAATGGCTTTAATTTTT

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 57.80% 30.80% 3.07% 8.32% NA
All Indica  2759 56.70% 29.10% 4.60% 9.68% NA
All Japonica  1512 53.30% 38.80% 0.60% 7.28% NA
Aus  269 82.20% 14.90% 0.37% 2.60% NA
Indica I  595 59.80% 30.90% 8.24% 1.01% NA
Indica II  465 66.90% 20.40% 6.24% 6.45% NA
Indica III  913 44.40% 36.40% 2.96% 16.32% NA
Indica Intermediate  786 62.50% 24.30% 2.80% 10.43% NA
Temperate Japonica  767 78.70% 17.70% 0.65% 2.87% NA
Tropical Japonica  504 14.10% 70.00% 0.79% 15.08% NA
Japonica Intermediate  241 54.40% 40.70% 0.00% 4.98% NA
VI/Aromatic  96 99.00% 1.00% 0.00% 0.00% NA
Intermediate  90 53.30% 27.80% 8.89% 10.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1125888962 G -> A LOC_Os11g42940.1 upstream_gene_variant ; 1569.0bp to feature; MODIFIER silent_mutation Average:69.763; most accessible tissue: Callus, score: 91.985 N N N N
vg1125888962 G -> A LOC_Os11g42950.1 downstream_gene_variant ; 1555.0bp to feature; MODIFIER silent_mutation Average:69.763; most accessible tissue: Callus, score: 91.985 N N N N
vg1125888962 G -> A LOC_Os11g42960.1 downstream_gene_variant ; 4757.0bp to feature; MODIFIER silent_mutation Average:69.763; most accessible tissue: Callus, score: 91.985 N N N N
vg1125888962 G -> A LOC_Os11g42940-LOC_Os11g42950 intergenic_region ; MODIFIER silent_mutation Average:69.763; most accessible tissue: Callus, score: 91.985 N N N N
vg1125888962 G -> DEL N N silent_mutation Average:69.763; most accessible tissue: Callus, score: 91.985 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1125888962 7.09E-12 5.32E-10 mr1191 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125888962 3.40E-16 2.63E-21 mr1191 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125888962 NA 4.92E-06 mr1380 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125888962 NA 3.01E-06 mr1380 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125888962 NA 8.15E-06 mr1561 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125888962 NA 1.04E-07 mr1561 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125888962 2.14E-13 3.40E-13 mr1644 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125888962 5.46E-18 2.20E-25 mr1644 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125888962 NA 1.20E-06 mr1908 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125888962 NA 2.82E-07 mr1937 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125888962 NA 1.70E-06 mr1937 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125888962 1.94E-10 NA mr1191_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125888962 7.73E-15 1.19E-24 mr1191_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251