Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923).

Detailed information for vg1125888962:

Variant ID: vg1125888962 (JBrowse)	Variation Type: SNP
Chromosome: chr11	Position: 25888962
Reference Allele: G	Alternative Allele: A
Primary Allele: G	Secondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 1.00, others allele: 0.00, population size: 115. )

Flanking Sequence (100 bp) in Reference Genome:

AAAAATTAAAGCCATTACTATAAAAATCCACATTGCATGGACATATTATTTTTTAGATAAAATGAATCTTTCGCTAAGTAATAAAATTAAATAAAATTTT[G/A]
CGGTGCTTAAAAAATACCTAGAGATACTAAAATTTTACACCAAAACTTTTGGTATCTCAAAGTATCTAGTACTTAAAAATACCAAGATTTACACTAGAAA

Reverse complement sequence

TTTCTAGTGTAAATCTTGGTATTTTTAAGTACTAGATACTTTGAGATACCAAAAGTTTTGGTGTAAAATTTTAGTATCTCTAGGTATTTTTTAAGCACCG[C/T]
AAAATTTTATTTAATTTTATTACTTAGCGAAAGATTCATTTTATCTAAAAAATAATATGTCCATGCAATGTGGATTTTTATAGTAATGGCTTTAATTTTT

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	57.80%	30.80%	3.07%	8.32%	NA
All Indica	2759	56.70%	29.10%	4.60%	9.68%	NA
All Japonica	1512	53.30%	38.80%	0.60%	7.28%	NA
Aus	269	82.20%	14.90%	0.37%	2.60%	NA
Indica I	595	59.80%	30.90%	8.24%	1.01%	NA
Indica II	465	66.90%	20.40%	6.24%	6.45%	NA
Indica III	913	44.40%	36.40%	2.96%	16.32%	NA
Indica Intermediate	786	62.50%	24.30%	2.80%	10.43%	NA
Temperate Japonica	767	78.70%	17.70%	0.65%	2.87%	NA
Tropical Japonica	504	14.10%	70.00%	0.79%	15.08%	NA
Japonica Intermediate	241	54.40%	40.70%	0.00%	4.98%	NA
VI/Aromatic	96	99.00%	1.00%	0.00%	0.00%	NA
Intermediate	90	53.30%	27.80%	8.89%	10.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1125888962	G -> A	LOC_Os11g42940.1	upstream_gene_variant ; 1569.0bp to feature; MODIFIER	silent_mutation	Average:69.763; most accessible tissue: Callus, score: 91.985	N	N	N	N
vg1125888962	G -> A	LOC_Os11g42950.1	downstream_gene_variant ; 1555.0bp to feature; MODIFIER	silent_mutation	Average:69.763; most accessible tissue: Callus, score: 91.985	N	N	N	N
vg1125888962	G -> A	LOC_Os11g42960.1	downstream_gene_variant ; 4757.0bp to feature; MODIFIER	silent_mutation	Average:69.763; most accessible tissue: Callus, score: 91.985	N	N	N	N
vg1125888962	G -> A	LOC_Os11g42940-LOC_Os11g42950	intergenic_region ; MODIFIER	silent_mutation	Average:69.763; most accessible tissue: Callus, score: 91.985	N	N	N	N
vg1125888962	G -> DEL	N	N	silent_mutation	Average:69.763; most accessible tissue: Callus, score: 91.985	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1125888962	7.09E-12	5.32E-10	mr1191	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125888962	3.40E-16	2.63E-21	mr1191	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125888962	NA	4.92E-06	mr1380	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125888962	NA	3.01E-06	mr1380	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125888962	NA	8.15E-06	mr1561	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125888962	NA	1.04E-07	mr1561	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125888962	2.14E-13	3.40E-13	mr1644	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125888962	5.46E-18	2.20E-25	mr1644	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125888962	NA	1.20E-06	mr1908	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125888962	NA	2.82E-07	mr1937	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125888962	NA	1.70E-06	mr1937	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125888962	1.94E-10	NA	mr1191_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125888962	7.73E-15	1.19E-24	mr1191_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251