\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1125878225:

Variant ID: vg1125878225 (JBrowse)Variation Type: SNP
Chromosome: chr11Position: 25878225
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.69, T: 0.30, others allele: 0.00, population size: 232. )

Flanking Sequence (100 bp) in Reference Genome:


TTCGCAGGGTGCTTCAGAGCAACCATCCCTTGATTCGCGCAACCATGACAATAGCCTAATTTTAAAAACATACACATAAATACATAGAACAACAAAGTTG[C/T]
AACAAATCTAAAGATATATAACTGTTCATGTTGAACGAAACAAATGAGAAGAAAGACATACCATCATCATGTGATTTCACAGGCCAACATAAATAGAATT

Reverse complement sequence

AATTCTATTTATGTTGGCCTGTGAAATCACATGATGATGGTATGTCTTTCTTCTCATTTGTTTCGTTCAACATGAACAGTTATATATCTTTAGATTTGTT[G/A]
CAACTTTGTTGTTCTATGTATTTATGTGTATGTTTTTAAAATTAGGCTATTGTCATGGTTGCGCGAATCAAGGGATGGTTGCTCTGAAGCACCCTGCGAA

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 62.30% 13.20% 2.07% 22.41% NA
All Indica  2759 45.80% 19.20% 2.72% 32.33% NA
All Japonica  1512 88.40% 4.00% 0.93% 6.68% NA
Aus  269 74.00% 8.20% 1.49% 16.36% NA
Indica I  595 46.90% 31.10% 0.84% 21.18% NA
Indica II  465 64.30% 12.00% 1.51% 22.15% NA
Indica III  913 38.90% 13.60% 3.83% 43.70% NA
Indica Intermediate  786 42.00% 20.90% 3.56% 33.59% NA
Temperate Japonica  767 92.20% 3.80% 0.78% 3.26% NA
Tropical Japonica  504 81.70% 4.80% 0.79% 12.70% NA
Japonica Intermediate  241 90.00% 3.30% 1.66% 4.98% NA
VI/Aromatic  96 97.90% 0.00% 0.00% 2.08% NA
Intermediate  90 56.70% 15.60% 5.56% 22.22% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1125878225 C -> T LOC_Os11g42920.1 upstream_gene_variant ; 2133.0bp to feature; MODIFIER silent_mutation Average:51.312; most accessible tissue: Zhenshan97 young leaf, score: 75.397 N N N N
vg1125878225 C -> T LOC_Os11g42930.1 intron_variant ; MODIFIER silent_mutation Average:51.312; most accessible tissue: Zhenshan97 young leaf, score: 75.397 N N N N
vg1125878225 C -> DEL N N silent_mutation Average:51.312; most accessible tissue: Zhenshan97 young leaf, score: 75.397 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1125878225 7.49E-13 1.49E-20 mr1191 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125878225 4.65E-09 1.44E-12 mr1191 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125878225 NA 1.74E-06 mr1561 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125878225 2.01E-17 1.76E-28 mr1644 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125878225 2.09E-12 9.35E-19 mr1644 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125878225 1.03E-14 1.21E-30 mr1191_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125878225 1.55E-10 1.15E-18 mr1191_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125878225 NA 1.74E-06 mr1380_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125878225 NA 1.81E-06 mr1380_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125878225 NA 1.82E-07 mr1561_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125878225 NA 1.79E-07 mr1875_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125878225 NA 9.37E-07 mr1908_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125878225 NA 2.15E-06 mr1996_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251