Search for Variation information by Variation ID:
Detailed information for vg1125863852:
| Variant ID: vg1125863852 (JBrowse) | Variation Type: SNP |
| Chromosome: chr11 | Position: 25863852 |
| Reference Allele: A | Alternative Allele: G |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.61, A: 0.38, others allele: 0.00, population size: 76. )
Flanking Sequence (100 bp) in Reference Genome:
GTTTGGTGAAGTTGATAGTGTATCTGACAGAGGGGGAATCTTTGCAGAATTAGTTCATGATGTGATAGAGCGAAAGTGTATCTTGAAATGGAACACTATC[A/G]
CTACAATTCAATCAAAATATGCACTCGAATCTGATAATTTCCATGGTTCTAGCTCTGCAAGTTCAAATGAAACCATACACCAGGTAAAGTTTATATACTG
Reverse complement sequence
CAGTATATAAACTTTACCTGGTGTATGGTTTCATTTGAACTTGCAGAGCTAGAACCATGGAAATTATCAGATTCGAGTGCATATTTTGATTGAATTGTAG[T/C]
GATAGTGTTCCATTTCAAGATACACTTTCGCTCTATCACATCATGAACTAATTCTGCAAAGATTCCCCCTCTGTCAGATACACTATCAACTTCACCAAAC
Allele Frequencies:
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 35.90% | 27.10% | 10.88% | 26.20% | NA |
| All Indica | 2759 | 52.60% | 17.50% | 11.38% | 18.48% | NA |
| All Japonica | 1512 | 8.70% | 42.90% | 8.53% | 39.81% | NA |
| Aus | 269 | 26.00% | 26.00% | 22.30% | 25.65% | NA |
| Indica I | 595 | 53.40% | 42.90% | 1.51% | 2.18% | NA |
| Indica II | 465 | 36.30% | 5.80% | 33.12% | 24.73% | NA |
| Indica III | 913 | 55.60% | 11.40% | 7.45% | 25.52% | NA |
| Indica Intermediate | 786 | 58.00% | 12.50% | 10.56% | 18.96% | NA |
| Temperate Japonica | 767 | 7.60% | 62.20% | 3.52% | 26.73% | NA |
| Tropical Japonica | 504 | 10.30% | 13.70% | 13.69% | 62.30% | NA |
| Japonica Intermediate | 241 | 9.10% | 42.70% | 13.69% | 34.44% | NA |
| VI/Aromatic | 96 | 3.10% | 54.20% | 5.21% | 37.50% | NA |
| Intermediate | 90 | 43.30% | 26.70% | 6.67% | 23.33% | NA |
Allele Effect:
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1125863852 | A -> DEL | LOC_Os11g42910.1 | N | frameshift_variant | Average:24.666; most accessible tissue: Zhenshan97 young leaf, score: 44.598 | N | N | N | N |
| vg1125863852 | A -> G | LOC_Os11g42910.1 | missense_variant ; p.Thr998Ala; MODERATE | nonsynonymous_codon ; T998A | Average:24.666; most accessible tissue: Zhenshan97 young leaf, score: 44.598 | benign  |
-1.244 |
TOLERATED | 1.00 |
Putative Genotype-Phenotype Associations:
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1125863852 | 3.78E-11 | 1.13E-18 | mr1191 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1125863852 | 4.67E-07 | 1.64E-10 | mr1191 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1125863852 | NA | 5.06E-06 | mr1561 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1125863852 | 3.86E-16 | 2.44E-27 | mr1644 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1125863852 | 1.24E-09 | 7.53E-16 | mr1644 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1125863852 | 5.22E-07 | 5.22E-07 | mr1644 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1125863852 | 6.28E-13 | 4.06E-29 | mr1191_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1125863852 | 1.95E-08 | 7.85E-16 | mr1191_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1125863852 | 4.40E-07 | 4.40E-07 | mr1191_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1125863852 | NA | 1.54E-06 | mr1462_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1125863852 | NA | 1.00E-06 | mr1875_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |