\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1125839534:

Variant ID: vg1125839534 (JBrowse)Variation Type: SNP
Chromosome: chr11Position: 25839534
Reference Allele: CAlternative Allele: T,A
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.78, C: 0.23, others allele: 0.00, population size: 159. )

Flanking Sequence (100 bp) in Reference Genome:


GGTATAAATAGAGGGAGAGGGTATGGCCTCCCGGTATCGGTTGTAAGTGAGGCAAATTTGAGAGATTAGATAGGGTTTCGTAAGAAACTTGTAAGGGGTG[C/T,A]
TGTGGCTGCACCTTGTGAACAATACTTGAATAATAAAGATCATATTCAATCATCAAGGTATCGACGATCTATTTCGGTTTTGTAAGTTTTACGTTTATGT

Reverse complement sequence

ACATAAACGTAAAACTTACAAAACCGAAATAGATCGTCGATACCTTGATGATTGAATATGATCTTTATTATTCAAGTATTGTTCACAAGGTGCAGCCACA[G/A,T]
CACCCCTTACAAGTTTCTTACGAAACCCTATCTAATCTCTCAAATTTGCCTCACTTACAACCGATACCGGGAGGCCATACCCTCTCCCTCTATTTATACC

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 57.40% 39.00% 1.18% 2.41% NA
All Indica  2759 58.60% 35.80% 1.78% 3.88% NA
All Japonica  1512 56.00% 43.90% 0.00% 0.07% NA
Aus  269 51.30% 45.40% 1.49% 1.86% NA
Indica I  595 81.50% 10.90% 3.36% 4.20% NA
Indica II  465 37.00% 52.50% 1.72% 8.82% NA
Indica III  913 61.00% 37.20% 0.55% 1.20% NA
Indica Intermediate  786 51.10% 43.00% 2.04% 3.82% NA
Temperate Japonica  767 79.00% 20.90% 0.00% 0.13% NA
Tropical Japonica  504 23.80% 76.20% 0.00% 0.00% NA
Japonica Intermediate  241 50.20% 49.80% 0.00% 0.00% NA
VI/Aromatic  96 52.10% 45.80% 2.08% 0.00% NA
Intermediate  90 71.10% 26.70% 1.11% 1.11% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1125839534 C -> T LOC_Os11g42890.1 upstream_gene_variant ; 2836.0bp to feature; MODIFIER silent_mutation Average:45.099; most accessible tissue: Callus, score: 66.297 N N N N
vg1125839534 C -> T LOC_Os11g42900.1 downstream_gene_variant ; 1059.0bp to feature; MODIFIER silent_mutation Average:45.099; most accessible tissue: Callus, score: 66.297 N N N N
vg1125839534 C -> T LOC_Os11g42890-LOC_Os11g42900 intergenic_region ; MODIFIER silent_mutation Average:45.099; most accessible tissue: Callus, score: 66.297 N N N N
vg1125839534 C -> A LOC_Os11g42890.1 upstream_gene_variant ; 2836.0bp to feature; MODIFIER N Average:45.099; most accessible tissue: Callus, score: 66.297 N N N N
vg1125839534 C -> A LOC_Os11g42900.1 downstream_gene_variant ; 1059.0bp to feature; MODIFIER N Average:45.099; most accessible tissue: Callus, score: 66.297 N N N N
vg1125839534 C -> A LOC_Os11g42890-LOC_Os11g42900 intergenic_region ; MODIFIER N Average:45.099; most accessible tissue: Callus, score: 66.297 N N N N
vg1125839534 C -> DEL N N silent_mutation Average:45.099; most accessible tissue: Callus, score: 66.297 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1125839534 1.16E-06 NA mr1191 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125839534 6.64E-06 2.12E-07 mr1191 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125839534 2.60E-10 1.55E-10 mr1644 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125839534 1.51E-08 2.76E-12 mr1644 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125839534 2.11E-06 NA mr1191_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125839534 NA 3.02E-10 mr1191_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251