\
| Variant ID: vg1125839534 (JBrowse) | Variation Type: SNP |
| Chromosome: chr11 | Position: 25839534 |
| Reference Allele: C | Alternative Allele: T,A |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.78, C: 0.23, others allele: 0.00, population size: 159. )
GGTATAAATAGAGGGAGAGGGTATGGCCTCCCGGTATCGGTTGTAAGTGAGGCAAATTTGAGAGATTAGATAGGGTTTCGTAAGAAACTTGTAAGGGGTG[C/T,A]
TGTGGCTGCACCTTGTGAACAATACTTGAATAATAAAGATCATATTCAATCATCAAGGTATCGACGATCTATTTCGGTTTTGTAAGTTTTACGTTTATGT
ACATAAACGTAAAACTTACAAAACCGAAATAGATCGTCGATACCTTGATGATTGAATATGATCTTTATTATTCAAGTATTGTTCACAAGGTGCAGCCACA[G/A,T]
CACCCCTTACAAGTTTCTTACGAAACCCTATCTAATCTCTCAAATTTGCCTCACTTACAACCGATACCGGGAGGCCATACCCTCTCCCTCTATTTATACC
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 57.40% | 39.00% | 1.18% | 2.41% | NA |
| All Indica | 2759 | 58.60% | 35.80% | 1.78% | 3.88% | NA |
| All Japonica | 1512 | 56.00% | 43.90% | 0.00% | 0.07% | NA |
| Aus | 269 | 51.30% | 45.40% | 1.49% | 1.86% | NA |
| Indica I | 595 | 81.50% | 10.90% | 3.36% | 4.20% | NA |
| Indica II | 465 | 37.00% | 52.50% | 1.72% | 8.82% | NA |
| Indica III | 913 | 61.00% | 37.20% | 0.55% | 1.20% | NA |
| Indica Intermediate | 786 | 51.10% | 43.00% | 2.04% | 3.82% | NA |
| Temperate Japonica | 767 | 79.00% | 20.90% | 0.00% | 0.13% | NA |
| Tropical Japonica | 504 | 23.80% | 76.20% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 50.20% | 49.80% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 52.10% | 45.80% | 2.08% | 0.00% | NA |
| Intermediate | 90 | 71.10% | 26.70% | 1.11% | 1.11% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1125839534 | C -> T | LOC_Os11g42890.1 | upstream_gene_variant ; 2836.0bp to feature; MODIFIER | silent_mutation | Average:45.099; most accessible tissue: Callus, score: 66.297 | N | N | N | N |
| vg1125839534 | C -> T | LOC_Os11g42900.1 | downstream_gene_variant ; 1059.0bp to feature; MODIFIER | silent_mutation | Average:45.099; most accessible tissue: Callus, score: 66.297 | N | N | N | N |
| vg1125839534 | C -> T | LOC_Os11g42890-LOC_Os11g42900 | intergenic_region ; MODIFIER | silent_mutation | Average:45.099; most accessible tissue: Callus, score: 66.297 | N | N | N | N |
| vg1125839534 | C -> A | LOC_Os11g42890.1 | upstream_gene_variant ; 2836.0bp to feature; MODIFIER | N | Average:45.099; most accessible tissue: Callus, score: 66.297 | N | N | N | N |
| vg1125839534 | C -> A | LOC_Os11g42900.1 | downstream_gene_variant ; 1059.0bp to feature; MODIFIER | N | Average:45.099; most accessible tissue: Callus, score: 66.297 | N | N | N | N |
| vg1125839534 | C -> A | LOC_Os11g42890-LOC_Os11g42900 | intergenic_region ; MODIFIER | N | Average:45.099; most accessible tissue: Callus, score: 66.297 | N | N | N | N |
| vg1125839534 | C -> DEL | N | N | silent_mutation | Average:45.099; most accessible tissue: Callus, score: 66.297 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1125839534 | 1.16E-06 | NA | mr1191 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1125839534 | 6.64E-06 | 2.12E-07 | mr1191 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1125839534 | 2.60E-10 | 1.55E-10 | mr1644 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1125839534 | 1.51E-08 | 2.76E-12 | mr1644 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1125839534 | 2.11E-06 | NA | mr1191_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1125839534 | NA | 3.02E-10 | mr1191_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |