\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1125838229:

Variant ID: vg1125838229 (JBrowse)Variation Type: SNP
Chromosome: chr11Position: 25838229
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


AGTCAAAATAATTAATAGTGAGAAATTTAAGACCATAATATATAGGGTTACGTGTCGCGTGCAAAAAATAATCACTGTAGTTTGGTGTAAATTGTACTCC[C/T]
TCCGTTTCAAGTTATAAGATATTTTGGCTTTGGTCAGACTTTGACCAAAGCCAAAATATTTTATAACCTGAAACGGAGGGAGTATCATAGTAGGTGGCTT

Reverse complement sequence

AAGCCACCTACTATGATACTCCCTCCGTTTCAGGTTATAAAATATTTTGGCTTTGGTCAAAGTCTGACCAAAGCCAAAATATCTTATAACTTGAAACGGA[G/A]
GGAGTACAATTTACACCAAACTACAGTGATTATTTTTTGCACGCGACACGTAACCCTATATATTATGGTCTTAAATTTCTCACTATTAATTATTTTGACT

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 61.70% 37.80% 0.44% 0.00% NA
All Indica  2759 71.80% 27.60% 0.58% 0.00% NA
All Japonica  1512 42.90% 57.00% 0.13% 0.00% NA
Aus  269 76.20% 22.70% 1.12% 0.00% NA
Indica I  595 58.30% 41.50% 0.17% 0.00% NA
Indica II  465 45.40% 52.30% 2.37% 0.00% NA
Indica III  913 90.60% 9.30% 0.11% 0.00% NA
Indica Intermediate  786 75.80% 23.80% 0.38% 0.00% NA
Temperate Japonica  767 57.20% 42.60% 0.13% 0.00% NA
Tropical Japonica  504 26.60% 73.40% 0.00% 0.00% NA
Japonica Intermediate  241 31.10% 68.50% 0.41% 0.00% NA
VI/Aromatic  96 22.90% 77.10% 0.00% 0.00% NA
Intermediate  90 67.80% 32.20% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1125838229 C -> T LOC_Os11g42890.1 upstream_gene_variant ; 1531.0bp to feature; MODIFIER silent_mutation Average:45.663; most accessible tissue: Minghui63 panicle, score: 79.811 N N N N
vg1125838229 C -> T LOC_Os11g42880.1 downstream_gene_variant ; 4804.0bp to feature; MODIFIER silent_mutation Average:45.663; most accessible tissue: Minghui63 panicle, score: 79.811 N N N N
vg1125838229 C -> T LOC_Os11g42900.1 downstream_gene_variant ; 2364.0bp to feature; MODIFIER silent_mutation Average:45.663; most accessible tissue: Minghui63 panicle, score: 79.811 N N N N
vg1125838229 C -> T LOC_Os11g42890-LOC_Os11g42900 intergenic_region ; MODIFIER silent_mutation Average:45.663; most accessible tissue: Minghui63 panicle, score: 79.811 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1125838229 NA 7.35E-11 mr1133 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125838229 1.98E-08 5.81E-13 mr1191 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125838229 4.42E-10 2.53E-13 mr1191 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125838229 2.04E-06 NA mr1238 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125838229 NA 2.58E-06 mr1561 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125838229 NA 2.79E-06 mr1561 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125838229 4.29E-06 NA mr1566 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125838229 6.35E-06 6.35E-06 mr1566 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125838229 8.37E-06 8.37E-06 mr1609 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125838229 3.29E-13 1.03E-19 mr1644 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125838229 9.28E-14 4.89E-20 mr1644 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125838229 NA 6.44E-07 mr1667 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125838229 NA 8.53E-07 mr1133_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125838229 2.25E-12 1.23E-19 mr1191_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125838229 7.79E-12 5.31E-18 mr1191_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125838229 3.23E-06 NA mr1238_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125838229 NA 3.44E-06 mr1380_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125838229 5.21E-06 NA mr1609_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125838229 1.08E-06 NA mr1841_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125838229 8.17E-07 NA mr1900_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251