\
| Variant ID: vg1125822467 (JBrowse) | Variation Type: SNP |
| Chromosome: chr11 | Position: 25822467 |
| Reference Allele: C | Alternative Allele: T |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.82, T: 0.18, others allele: 0.00, population size: 108. )
AGCTATTTGCTATACTCTCTTCCTCCCATTTCCCATTTTAAAGTTTTCGTGTTAAATGTTTTATTTAAAAAATTAAAAAATATTAGTCATATATAAAGTA[C/T]
TATTTATTTTTTATTATCTAATAATAATAAAATATGACTAATCATAAAAATATTTTAAATAAGACAGATAATCAAAGTTGGATTCAGAAACTCATAACTG
CAGTTATGAGTTTCTGAATCCAACTTTGATTATCTGTCTTATTTAAAATATTTTTATGATTAGTCATATTTTATTATTATTAGATAATAAAAAATAAATA[G/A]
TACTTTATATATGACTAATATTTTTTAATTTTTTAAATAAAACATTTAACACGAAAACTTTAAAATGGGAAATGGGAGGAAGAGAGTATAGCAAATAGCT
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 74.80% | 24.00% | 0.80% | 0.40% | NA |
| All Indica | 2759 | 64.50% | 33.90% | 1.23% | 0.40% | NA |
| All Japonica | 1512 | 93.40% | 6.40% | 0.13% | 0.07% | NA |
| Aus | 269 | 67.30% | 31.60% | 0.37% | 0.74% | NA |
| Indica I | 595 | 91.60% | 7.60% | 0.67% | 0.17% | NA |
| Indica II | 465 | 82.20% | 17.40% | 0.43% | 0.00% | NA |
| Indica III | 913 | 46.10% | 51.70% | 1.53% | 0.66% | NA |
| Indica Intermediate | 786 | 54.80% | 42.90% | 1.78% | 0.51% | NA |
| Temperate Japonica | 767 | 98.20% | 1.80% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 85.50% | 14.10% | 0.20% | 0.20% | NA |
| Japonica Intermediate | 241 | 94.60% | 5.00% | 0.41% | 0.00% | NA |
| VI/Aromatic | 96 | 95.80% | 0.00% | 0.00% | 4.17% | NA |
| Intermediate | 90 | 76.70% | 21.10% | 1.11% | 1.11% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1125822467 | C -> T | LOC_Os11g42860.1 | upstream_gene_variant ; 4449.0bp to feature; MODIFIER | silent_mutation | Average:38.249; most accessible tissue: Minghui63 panicle, score: 85.069 | N | N | N | N |
| vg1125822467 | C -> T | LOC_Os11g42870.1 | downstream_gene_variant ; 328.0bp to feature; MODIFIER | silent_mutation | Average:38.249; most accessible tissue: Minghui63 panicle, score: 85.069 | N | N | N | N |
| vg1125822467 | C -> T | LOC_Os11g42860-LOC_Os11g42870 | intergenic_region ; MODIFIER | silent_mutation | Average:38.249; most accessible tissue: Minghui63 panicle, score: 85.069 | N | N | N | N |
| vg1125822467 | C -> DEL | N | N | silent_mutation | Average:38.249; most accessible tissue: Minghui63 panicle, score: 85.069 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1125822467 | NA | 7.61E-07 | mr1063 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1125822467 | 7.30E-10 | 4.02E-28 | mr1133 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1125822467 | 2.61E-09 | 1.40E-18 | mr1133 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1125822467 | NA | 7.10E-09 | mr1533 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1125822467 | NA | 8.07E-08 | mr1662 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1125822467 | 9.92E-07 | 9.50E-16 | mr1667 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1125822467 | 2.14E-06 | 4.43E-11 | mr1667 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1125822467 | NA | 7.18E-11 | mr1980 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1125822467 | 1.15E-07 | 1.19E-22 | mr1133_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1125822467 | 1.92E-07 | 1.70E-17 | mr1133_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1125822467 | NA | 5.55E-07 | mr1662_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1125822467 | 8.82E-07 | 1.40E-14 | mr1667_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1125822467 | 8.73E-07 | 6.71E-12 | mr1667_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |