\
| Variant ID: vg1125812120 (JBrowse) | Variation Type: SNP |
| Chromosome: chr11 | Position: 25812120 |
| Reference Allele: T | Alternative Allele: C |
| Primary Allele: T | Secondary Allele: C |
Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 1.00, C: 0.00, others allele: 0.00, population size: 213. )
TTCCTTTTTTAGAATCCTTCCCAAAAATTTCTCAAAAGATTCCCTCTGGAGCCAATATGTACCATATAGGTAGACAAGCCACCCCAGCATGTATCCCAGC[T/C]
GCACGGCCTGACCTATTGTTAATTTTTCAAAGCACTGCCCATCACAAATAGCACCACTTTGAACAACTCAACTCCCAAGAAATGGATTTAAAATGCAACC
GGTTGCATTTTAAATCCATTTCTTGGGAGTTGAGTTGTTCAAAGTGGTGCTATTTGTGATGGGCAGTGCTTTGAAAAATTAACAATAGGTCAGGCCGTGC[A/G]
GCTGGGATACATGCTGGGGTGGCTTGTCTACCTATATGGTACATATTGGCTCCAGAGGGAATCTTTTGAGAAATTTTTGGGAAGGATTCTAAAAAAGGAA
| Populations | Population Size | Frequency of T(primary allele) | Frequency of C(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 71.70% | 28.10% | 0.19% | 0.00% | NA |
| All Indica | 2759 | 58.60% | 41.10% | 0.25% | 0.00% | NA |
| All Japonica | 1512 | 90.10% | 9.90% | 0.00% | 0.00% | NA |
| Aus | 269 | 94.80% | 5.20% | 0.00% | 0.00% | NA |
| Indica I | 595 | 58.70% | 41.00% | 0.34% | 0.00% | NA |
| Indica II | 465 | 67.50% | 32.00% | 0.43% | 0.00% | NA |
| Indica III | 913 | 49.70% | 50.30% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 63.70% | 35.90% | 0.38% | 0.00% | NA |
| Temperate Japonica | 767 | 97.40% | 2.60% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 78.80% | 21.20% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 90.50% | 9.50% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 97.90% | 1.00% | 1.04% | 0.00% | NA |
| Intermediate | 90 | 64.40% | 34.40% | 1.11% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1125812120 | T -> C | LOC_Os11g42850.1 | upstream_gene_variant ; 1733.0bp to feature; MODIFIER | silent_mutation | Average:52.77; most accessible tissue: Callus, score: 67.906 | N | N | N | N |
| vg1125812120 | T -> C | LOC_Os11g42850.2 | upstream_gene_variant ; 1733.0bp to feature; MODIFIER | silent_mutation | Average:52.77; most accessible tissue: Callus, score: 67.906 | N | N | N | N |
| vg1125812120 | T -> C | LOC_Os11g42860.1 | intron_variant ; MODIFIER | silent_mutation | Average:52.77; most accessible tissue: Callus, score: 67.906 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1125812120 | 1.26E-18 | 7.55E-26 | mr1191 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1125812120 | 5.52E-15 | 7.15E-20 | mr1191 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1125812120 | 1.25E-06 | 1.25E-06 | mr1191 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1125812120 | 1.49E-06 | NA | mr1238 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1125812120 | NA | 3.91E-06 | mr1309 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1125812120 | NA | 3.01E-07 | mr1561 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1125812120 | 2.54E-26 | 1.18E-36 | mr1644 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1125812120 | 2.84E-22 | 1.70E-31 | mr1644 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1125812120 | 3.17E-07 | 3.17E-07 | mr1644 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1125812120 | NA | 7.01E-06 | mr1908 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1125812120 | NA | 6.22E-07 | mr1925 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1125812120 | 1.76E-23 | 1.06E-36 | mr1191_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1125812120 | 1.26E-19 | 5.38E-29 | mr1191_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1125812120 | 1.81E-06 | 1.81E-06 | mr1191_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1125812120 | NA | 6.74E-06 | mr1561_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1125812120 | NA | 4.69E-06 | mr1908_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |