Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923).

Detailed information for vg1125791323:

Variant ID: vg1125791323 (JBrowse)	Variation Type: SNP
Chromosome: chr11	Position: 25791323
Reference Allele: A	Alternative Allele: T
Primary Allele: A	Secondary Allele: T

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.68, T: 0.33, others allele: 0.00, population size: 80. )

Flanking Sequence (100 bp) in Reference Genome:

GCCCTGTTTTTAGTAGGGATTTGTTTTTCTCGTCTGGTTTTTTTTTCCGCCCCGTTTTTTTTTTGGATCGGTCTTTTTTTTTTTCTTTTTTTCGCCCGGT[A/T]
TTTTTAGTTCAGTAGCCAGTGATGGAATTTTATTTTTGTGAGGAACCAGTCCTATACGTCAGATCAATATGAGTAAGATTGGAAAACAAAAAATTTTGAT

Reverse complement sequence

ATCAAAATTTTTTGTTTTCCAATCTTACTCATATTGATCTGACGTATAGGACTGGTTCCTCACAAAAATAAAATTCCATCACTGGCTACTGAACTAAAAA[T/A]
ACCGGGCGAAAAAAAGAAAAAAAAAAAGACCGATCCAAAAAAAAAACGGGGCGGAAAAAAAAACCAGACGAGAAAAACAAATCCCTACTAAAAACAGGGC

Allele Frequencies:

Populations	Population Size	Frequency of A(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	38.60%	19.40%	4.82%	37.18%	NA
All Indica	2759	23.30%	25.30%	2.03%	49.37%	NA
All Japonica	1512	60.10%	10.00%	10.71%	19.18%	NA
Aus	269	74.00%	3.00%	0.74%	22.30%	NA
Indica I	595	46.40%	33.10%	0.84%	19.66%	NA
Indica II	465	11.00%	22.80%	3.87%	62.37%	NA
Indica III	913	11.30%	28.30%	2.30%	58.16%	NA
Indica Intermediate	786	27.20%	17.30%	1.53%	53.94%	NA
Temperate Japonica	767	84.40%	3.50%	6.39%	5.74%	NA
Tropical Japonica	504	26.60%	19.60%	18.06%	35.71%	NA
Japonica Intermediate	241	53.10%	10.40%	9.13%	27.39%	NA
VI/Aromatic	96	42.70%	39.60%	1.04%	16.67%	NA
Intermediate	90	33.30%	26.70%	7.78%	32.22%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1125791323	A -> T	LOC_Os11g42810.1	upstream_gene_variant ; 1903.0bp to feature; MODIFIER	silent_mutation	Average:26.566; most accessible tissue: Callus, score: 53.386	N	N	N	N
vg1125791323	A -> T	LOC_Os11g42820.1	downstream_gene_variant ; 1265.0bp to feature; MODIFIER	silent_mutation	Average:26.566; most accessible tissue: Callus, score: 53.386	N	N	N	N
vg1125791323	A -> T	LOC_Os11g42830.1	downstream_gene_variant ; 3491.0bp to feature; MODIFIER	silent_mutation	Average:26.566; most accessible tissue: Callus, score: 53.386	N	N	N	N
vg1125791323	A -> T	LOC_Os11g42810-LOC_Os11g42820	intergenic_region ; MODIFIER	silent_mutation	Average:26.566; most accessible tissue: Callus, score: 53.386	N	N	N	N
vg1125791323	A -> DEL	N	N	silent_mutation	Average:26.566; most accessible tissue: Callus, score: 53.386	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1125791323	4.69E-11	7.74E-10	mr1191	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125791323	2.41E-14	7.92E-19	mr1191	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125791323	6.86E-11	4.15E-12	mr1644	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125791323	5.46E-15	2.61E-20	mr1644	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125791323	NA	2.94E-06	mr1662	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125791323	2.95E-12	2.07E-13	mr1191_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125791323	5.04E-16	6.56E-27	mr1191_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125791323	NA	3.19E-07	mr1662_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251