\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1125786368:

Variant ID: vg1125786368 (JBrowse)Variation Type: SNP
Chromosome: chr11Position: 25786368
Reference Allele: GAlternative Allele: A
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.99, A: 0.01, others allele: 0.00, population size: 92. )

Flanking Sequence (100 bp) in Reference Genome:


TTTTAACTTTTTAAGTTTATTATAGAAAAATGGTAGCAATATTTTCAGCACAAAACAAATACAATATCAAAATATATTCAATGCTAGATTAAACTAATTT[G/A]
ATATTGTAGATGTTGCTATGTTTTTATATTAACATTGTCAAACTTATCAATGTTTGGATTTAGAAAAAATAATGTCTTATAATGTGAAATAGAGGGAGTG

Reverse complement sequence

CACTCCCTCTATTTCACATTATAAGACATTATTTTTTCTAAATCCAAACATTGATAAGTTTGACAATGTTAATATAAAAACATAGCAACATCTACAATAT[C/T]
AAATTAGTTTAATCTAGCATTGAATATATTTTGATATTGTATTTGTTTTGTGCTGAAAATATTGCTACCATTTTTCTATAATAAACTTAAAAAGTTAAAA

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 69.00% 15.10% 0.95% 15.00% NA
All Indica  2759 54.20% 22.30% 1.38% 22.18% NA
All Japonica  1512 94.90% 3.40% 0.40% 1.26% NA
Aus  269 83.30% 1.90% 0.00% 14.87% NA
Indica I  595 63.00% 28.20% 1.01% 7.73% NA
Indica II  465 25.60% 19.10% 2.37% 52.90% NA
Indica III  913 56.40% 24.90% 1.53% 17.20% NA
Indica Intermediate  786 61.70% 16.70% 0.89% 20.74% NA
Temperate Japonica  767 96.70% 2.00% 0.00% 1.30% NA
Tropical Japonica  504 91.90% 5.80% 0.99% 1.39% NA
Japonica Intermediate  241 95.40% 3.30% 0.41% 0.83% NA
VI/Aromatic  96 45.80% 25.00% 1.04% 28.12% NA
Intermediate  90 68.90% 18.90% 0.00% 12.22% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1125786368 G -> A LOC_Os11g42810.1 intron_variant ; MODIFIER silent_mutation Average:31.122; most accessible tissue: Zhenshan97 panicle, score: 52.263 N N N N
vg1125786368 G -> DEL N N silent_mutation Average:31.122; most accessible tissue: Zhenshan97 panicle, score: 52.263 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1125786368 5.21E-20 2.49E-32 mr1191 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125786368 6.26E-16 1.99E-23 mr1191 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125786368 NA 2.10E-06 mr1380 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125786368 4.18E-06 5.82E-10 mr1561 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125786368 NA 2.89E-06 mr1561 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125786368 2.16E-23 1.47E-38 mr1644 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125786368 1.23E-17 4.79E-27 mr1644 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125786368 NA 3.11E-06 mr1662 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125786368 NA 3.05E-06 mr1875 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125786368 NA 9.02E-08 mr1908 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125786368 1.14E-29 2.38E-48 mr1191_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125786368 2.63E-23 1.74E-38 mr1191_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125786368 1.82E-06 1.82E-06 mr1191_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125786368 5.35E-07 4.28E-12 mr1380_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125786368 NA 1.78E-08 mr1380_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125786368 1.64E-07 1.93E-13 mr1561_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125786368 8.89E-06 2.18E-08 mr1561_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125786368 5.98E-06 1.36E-10 mr1662_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125786368 NA 6.38E-07 mr1662_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125786368 3.49E-06 3.02E-11 mr1875_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125786368 NA 4.08E-07 mr1875_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125786368 4.62E-07 9.69E-13 mr1908_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125786368 NA 1.65E-07 mr1908_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125786368 1.85E-06 7.91E-09 mr1996_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251