Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1125663697:

Variant ID: vg1125663697 (JBrowse)	Variation Type: SNP
Chromosome: chr11	Position: 25663697
Reference Allele: T	Alternative Allele: A
Primary Allele: T	Secondary Allele: A

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 1.00, others allele: 0.00, population size: 103. )

Flanking Sequence (100 bp) in Reference Genome:

AGGGGTCCCACGGACCAACACCAGGTTAGGTCCCAGACCATACTGTGCCAGGAAGCCCAGGGGTCCTCCCCGACACCACCCCGGCGAATCTACTTGTCCC[T/A]
TGGCATCAAGATTTCTCTGGCCTAGCTAATTACTCAGCCAGGGGCGTCCCATATCACCCATGTGGTCGTACTTGACATATGCTCGGATGTAATTCCCAAG

Reverse complement sequence

CTTGGGAATTACATCCGAGCATATGTCAAGTACGACCACATGGGTGATATGGGACGCCCCTGGCTGAGTAATTAGCTAGGCCAGAGAAATCTTGATGCCA[A/T]
GGGACAAGTAGATTCGCCGGGGTGGTGTCGGGGAGGACCCCTGGGCTTCCTGGCACAGTATGGTCTGGGACCTAACCTGGTGTTGGTCCGTGGGACCCCT

Allele Frequencies:

Populations	Population Size	Frequency of T(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	47.80%	7.60%	9.29%	35.29%	NA
All Indica	2759	48.90%	12.40%	11.24%	27.47%	NA
All Japonica	1512	45.90%	0.50%	5.36%	48.28%	NA
Aus	269	55.40%	0.00%	13.01%	31.60%	NA
Indica I	595	45.70%	32.90%	4.71%	16.64%	NA
Indica II	465	41.10%	17.60%	15.70%	25.59%	NA
Indica III	913	56.10%	0.30%	12.27%	31.33%	NA
Indica Intermediate	786	47.60%	7.80%	12.34%	32.32%	NA
Temperate Japonica	767	64.50%	0.90%	4.30%	30.25%	NA
Tropical Japonica	504	21.80%	0.00%	4.17%	74.01%	NA
Japonica Intermediate	241	36.90%	0.00%	11.20%	51.87%	NA
VI/Aromatic	96	36.50%	0.00%	4.17%	59.38%	NA
Intermediate	90	34.40%	13.30%	10.00%	42.22%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1125663697	T -> A	LOC_Os11g42620.1	upstream_gene_variant ; 280.0bp to feature; MODIFIER	silent_mutation	Average:12.826; most accessible tissue: Minghui63 panicle, score: 29.741	N	N	N	N
vg1125663697	T -> A	LOC_Os11g42630.1	upstream_gene_variant ; 3929.0bp to feature; MODIFIER	silent_mutation	Average:12.826; most accessible tissue: Minghui63 panicle, score: 29.741	N	N	N	N
vg1125663697	T -> A	LOC_Os11g42620-LOC_Os11g42630	intergenic_region ; MODIFIER	silent_mutation	Average:12.826; most accessible tissue: Minghui63 panicle, score: 29.741	N	N	N	N
vg1125663697	T -> DEL	N	N	silent_mutation	Average:12.826; most accessible tissue: Minghui63 panicle, score: 29.741	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1125663697	7.71E-09	1.65E-18	mr1191	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125663697	5.80E-09	4.36E-14	mr1191	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125663697	6.20E-11	2.48E-21	mr1644	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125663697	1.59E-09	4.52E-16	mr1644	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125663697	5.06E-07	1.85E-09	mr1662	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125663697	1.57E-06	3.57E-10	mr1662	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125663697	NA	3.96E-07	mr1745	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125663697	2.10E-11	3.38E-31	mr1191_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125663697	3.97E-10	1.43E-22	mr1191_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125663697	NA	7.73E-06	mr1380_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125663697	NA	1.61E-06	mr1530_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125663697	NA	5.18E-06	mr1561_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125663697	5.29E-07	2.35E-11	mr1662_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125663697	2.16E-07	7.65E-12	mr1662_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125663697	NA	8.79E-11	mr1745_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125663697	NA	6.68E-06	mr1908_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251