\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1125663697:

Variant ID: vg1125663697 (JBrowse)Variation Type: SNP
Chromosome: chr11Position: 25663697
Reference Allele: TAlternative Allele: A
Primary Allele: TSecondary Allele: A

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 1.00, others allele: 0.00, population size: 103. )

Flanking Sequence (100 bp) in Reference Genome:


AGGGGTCCCACGGACCAACACCAGGTTAGGTCCCAGACCATACTGTGCCAGGAAGCCCAGGGGTCCTCCCCGACACCACCCCGGCGAATCTACTTGTCCC[T/A]
TGGCATCAAGATTTCTCTGGCCTAGCTAATTACTCAGCCAGGGGCGTCCCATATCACCCATGTGGTCGTACTTGACATATGCTCGGATGTAATTCCCAAG

Reverse complement sequence

CTTGGGAATTACATCCGAGCATATGTCAAGTACGACCACATGGGTGATATGGGACGCCCCTGGCTGAGTAATTAGCTAGGCCAGAGAAATCTTGATGCCA[A/T]
GGGACAAGTAGATTCGCCGGGGTGGTGTCGGGGAGGACCCCTGGGCTTCCTGGCACAGTATGGTCTGGGACCTAACCTGGTGTTGGTCCGTGGGACCCCT

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 47.80% 7.60% 9.29% 35.29% NA
All Indica  2759 48.90% 12.40% 11.24% 27.47% NA
All Japonica  1512 45.90% 0.50% 5.36% 48.28% NA
Aus  269 55.40% 0.00% 13.01% 31.60% NA
Indica I  595 45.70% 32.90% 4.71% 16.64% NA
Indica II  465 41.10% 17.60% 15.70% 25.59% NA
Indica III  913 56.10% 0.30% 12.27% 31.33% NA
Indica Intermediate  786 47.60% 7.80% 12.34% 32.32% NA
Temperate Japonica  767 64.50% 0.90% 4.30% 30.25% NA
Tropical Japonica  504 21.80% 0.00% 4.17% 74.01% NA
Japonica Intermediate  241 36.90% 0.00% 11.20% 51.87% NA
VI/Aromatic  96 36.50% 0.00% 4.17% 59.38% NA
Intermediate  90 34.40% 13.30% 10.00% 42.22% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1125663697 T -> A LOC_Os11g42620.1 upstream_gene_variant ; 280.0bp to feature; MODIFIER silent_mutation Average:12.826; most accessible tissue: Minghui63 panicle, score: 29.741 N N N N
vg1125663697 T -> A LOC_Os11g42630.1 upstream_gene_variant ; 3929.0bp to feature; MODIFIER silent_mutation Average:12.826; most accessible tissue: Minghui63 panicle, score: 29.741 N N N N
vg1125663697 T -> A LOC_Os11g42620-LOC_Os11g42630 intergenic_region ; MODIFIER silent_mutation Average:12.826; most accessible tissue: Minghui63 panicle, score: 29.741 N N N N
vg1125663697 T -> DEL N N silent_mutation Average:12.826; most accessible tissue: Minghui63 panicle, score: 29.741 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1125663697 7.71E-09 1.65E-18 mr1191 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125663697 5.80E-09 4.36E-14 mr1191 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125663697 6.20E-11 2.48E-21 mr1644 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125663697 1.59E-09 4.52E-16 mr1644 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125663697 5.06E-07 1.85E-09 mr1662 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125663697 1.57E-06 3.57E-10 mr1662 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125663697 NA 3.96E-07 mr1745 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125663697 2.10E-11 3.38E-31 mr1191_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125663697 3.97E-10 1.43E-22 mr1191_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125663697 NA 7.73E-06 mr1380_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125663697 NA 1.61E-06 mr1530_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125663697 NA 5.18E-06 mr1561_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125663697 5.29E-07 2.35E-11 mr1662_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125663697 2.16E-07 7.65E-12 mr1662_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125663697 NA 8.79E-11 mr1745_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125663697 NA 6.68E-06 mr1908_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251