Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1125609734:

Variant ID: vg1125609734 (JBrowse)	Variation Type: SNP
Chromosome: chr11	Position: 25609734
Reference Allele: T	Alternative Allele: C
Primary Allele: T	Secondary Allele: C

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.64, C: 0.36, others allele: 0.00, population size: 116. )

Flanking Sequence (100 bp) in Reference Genome:

ACCTACACGGTAGCCACACCGGACCTCCCCCCTCCCCGTCACCTCCTTCGTCGCACTGCAGACGAGAGGGACGAGGGAGCGAGAGGAGGCGGCATCAAGT[T/C]
TGTTGGATCTAGCTCCCGCCACACCATCGTACCTTCTCCCTAACTGTGCTGTCGCTGTACTTTCTACACGACTGCTCCGCCGATGCATCCGCATTAATTG

Reverse complement sequence

CAATTAATGCGGATGCATCGGCGGAGCAGTCGTGTAGAAAGTACAGCGACAGCACAGTTAGGGAGAAGGTACGATGGTGTGGCGGGAGCTAGATCCAACA[A/G]
ACTTGATGCCGCCTCCTCTCGCTCCCTCGTCCCTCTCGTCTGCAGTGCGACGAAGGAGGTGACGGGGAGGGGGGAGGTCCGGTGTGGCTACCGTGTAGGT

Allele Frequencies:

Populations	Population Size	Frequency of T(primary allele)	Frequency of C(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	50.80%	48.50%	0.72%	0.00%	NA
All Indica	2759	29.30%	70.60%	0.14%	0.00%	NA
All Japonica	1512	91.00%	7.30%	1.72%	0.00%	NA
Aus	269	45.70%	53.90%	0.37%	0.00%	NA
Indica I	595	81.70%	18.20%	0.17%	0.00%	NA
Indica II	465	22.80%	77.20%	0.00%	0.00%	NA
Indica III	913	4.30%	95.50%	0.22%	0.00%	NA
Indica Intermediate	786	22.50%	77.40%	0.13%	0.00%	NA
Temperate Japonica	767	96.00%	4.00%	0.00%	0.00%	NA
Tropical Japonica	504	82.90%	12.30%	4.76%	0.00%	NA
Japonica Intermediate	241	92.10%	7.10%	0.83%	0.00%	NA
VI/Aromatic	96	44.80%	54.20%	1.04%	0.00%	NA
Intermediate	90	55.60%	42.20%	2.22%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1125609734	T -> C	LOC_Os11g42525.1	upstream_gene_variant ; 2051.0bp to feature; MODIFIER	silent_mutation	Average:75.83; most accessible tissue: Callus, score: 96.87	N	N	N	N
vg1125609734	T -> C	LOC_Os11g42530.1	upstream_gene_variant ; 3649.0bp to feature; MODIFIER	silent_mutation	Average:75.83; most accessible tissue: Callus, score: 96.87	N	N	N	N
vg1125609734	T -> C	LOC_Os11g42540.1	upstream_gene_variant ; 4772.0bp to feature; MODIFIER	silent_mutation	Average:75.83; most accessible tissue: Callus, score: 96.87	N	N	N	N
vg1125609734	T -> C	LOC_Os11g42540.2	upstream_gene_variant ; 4772.0bp to feature; MODIFIER	silent_mutation	Average:75.83; most accessible tissue: Callus, score: 96.87	N	N	N	N
vg1125609734	T -> C	LOC_Os11g42520.1	downstream_gene_variant ; 938.0bp to feature; MODIFIER	silent_mutation	Average:75.83; most accessible tissue: Callus, score: 96.87	N	N	N	N
vg1125609734	T -> C	LOC_Os11g42520-LOC_Os11g42525	intergenic_region ; MODIFIER	silent_mutation	Average:75.83; most accessible tissue: Callus, score: 96.87	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1125609734	NA	3.91E-06	mr1030	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125609734	3.11E-07	2.14E-08	mr1133	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125609734	3.43E-06	3.43E-06	mr1191	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125609734	NA	9.76E-06	mr1309	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125609734	NA	2.73E-06	mr1378	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125609734	NA	7.26E-07	mr1496	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125609734	NA	1.96E-06	mr1530	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125609734	NA	2.36E-06	mr1580	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125609734	NA	2.45E-09	mr1637	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125609734	2.99E-07	2.98E-07	mr1644	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125609734	NA	4.20E-07	mr1662	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125609734	NA	7.01E-09	mr1745	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125609734	NA	8.46E-09	mr1804	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125609734	NA	1.69E-07	mr1904	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125609734	1.79E-06	1.38E-18	mr1133_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125609734	2.52E-08	2.53E-11	mr1133_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125609734	3.07E-07	3.07E-07	mr1191_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125609734	NA	8.10E-06	mr1530_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125609734	NA	2.72E-06	mr1662_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125609734	2.68E-06	4.98E-14	mr1667_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125609734	1.47E-06	4.26E-08	mr1667_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125609734	NA	2.17E-07	mr1745_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251