\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1125609734:

Variant ID: vg1125609734 (JBrowse)Variation Type: SNP
Chromosome: chr11Position: 25609734
Reference Allele: TAlternative Allele: C
Primary Allele: TSecondary Allele: C

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.64, C: 0.36, others allele: 0.00, population size: 116. )

Flanking Sequence (100 bp) in Reference Genome:


ACCTACACGGTAGCCACACCGGACCTCCCCCCTCCCCGTCACCTCCTTCGTCGCACTGCAGACGAGAGGGACGAGGGAGCGAGAGGAGGCGGCATCAAGT[T/C]
TGTTGGATCTAGCTCCCGCCACACCATCGTACCTTCTCCCTAACTGTGCTGTCGCTGTACTTTCTACACGACTGCTCCGCCGATGCATCCGCATTAATTG

Reverse complement sequence

CAATTAATGCGGATGCATCGGCGGAGCAGTCGTGTAGAAAGTACAGCGACAGCACAGTTAGGGAGAAGGTACGATGGTGTGGCGGGAGCTAGATCCAACA[A/G]
ACTTGATGCCGCCTCCTCTCGCTCCCTCGTCCCTCTCGTCTGCAGTGCGACGAAGGAGGTGACGGGGAGGGGGGAGGTCCGGTGTGGCTACCGTGTAGGT

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 50.80% 48.50% 0.72% 0.00% NA
All Indica  2759 29.30% 70.60% 0.14% 0.00% NA
All Japonica  1512 91.00% 7.30% 1.72% 0.00% NA
Aus  269 45.70% 53.90% 0.37% 0.00% NA
Indica I  595 81.70% 18.20% 0.17% 0.00% NA
Indica II  465 22.80% 77.20% 0.00% 0.00% NA
Indica III  913 4.30% 95.50% 0.22% 0.00% NA
Indica Intermediate  786 22.50% 77.40% 0.13% 0.00% NA
Temperate Japonica  767 96.00% 4.00% 0.00% 0.00% NA
Tropical Japonica  504 82.90% 12.30% 4.76% 0.00% NA
Japonica Intermediate  241 92.10% 7.10% 0.83% 0.00% NA
VI/Aromatic  96 44.80% 54.20% 1.04% 0.00% NA
Intermediate  90 55.60% 42.20% 2.22% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1125609734 T -> C LOC_Os11g42525.1 upstream_gene_variant ; 2051.0bp to feature; MODIFIER silent_mutation Average:75.83; most accessible tissue: Callus, score: 96.87 N N N N
vg1125609734 T -> C LOC_Os11g42530.1 upstream_gene_variant ; 3649.0bp to feature; MODIFIER silent_mutation Average:75.83; most accessible tissue: Callus, score: 96.87 N N N N
vg1125609734 T -> C LOC_Os11g42540.1 upstream_gene_variant ; 4772.0bp to feature; MODIFIER silent_mutation Average:75.83; most accessible tissue: Callus, score: 96.87 N N N N
vg1125609734 T -> C LOC_Os11g42540.2 upstream_gene_variant ; 4772.0bp to feature; MODIFIER silent_mutation Average:75.83; most accessible tissue: Callus, score: 96.87 N N N N
vg1125609734 T -> C LOC_Os11g42520.1 downstream_gene_variant ; 938.0bp to feature; MODIFIER silent_mutation Average:75.83; most accessible tissue: Callus, score: 96.87 N N N N
vg1125609734 T -> C LOC_Os11g42520-LOC_Os11g42525 intergenic_region ; MODIFIER silent_mutation Average:75.83; most accessible tissue: Callus, score: 96.87 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1125609734 NA 3.91E-06 mr1030 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125609734 3.11E-07 2.14E-08 mr1133 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125609734 3.43E-06 3.43E-06 mr1191 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125609734 NA 9.76E-06 mr1309 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125609734 NA 2.73E-06 mr1378 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125609734 NA 7.26E-07 mr1496 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125609734 NA 1.96E-06 mr1530 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125609734 NA 2.36E-06 mr1580 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125609734 NA 2.45E-09 mr1637 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125609734 2.99E-07 2.98E-07 mr1644 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125609734 NA 4.20E-07 mr1662 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125609734 NA 7.01E-09 mr1745 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125609734 NA 8.46E-09 mr1804 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125609734 NA 1.69E-07 mr1904 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125609734 1.79E-06 1.38E-18 mr1133_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125609734 2.52E-08 2.53E-11 mr1133_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125609734 3.07E-07 3.07E-07 mr1191_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125609734 NA 8.10E-06 mr1530_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125609734 NA 2.72E-06 mr1662_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125609734 2.68E-06 4.98E-14 mr1667_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125609734 1.47E-06 4.26E-08 mr1667_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125609734 NA 2.17E-07 mr1745_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251