Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1125609610:

Variant ID: vg1125609610 (JBrowse)	Variation Type: SNP
Chromosome: chr11	Position: 25609610
Reference Allele: A	Alternative Allele: G
Primary Allele: G	Secondary Allele: A

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.61, G: 0.39, others allele: 0.00, population size: 117. )

Flanking Sequence (100 bp) in Reference Genome:

TCTGCCGCTTTCTCCACCCTCCGCTCCACTCCTCTGACATTATCTCACCCTTTAGGCCTTCAATCGCTACCTCCATCTCCAACTCGGGCGTATGGCTGCC[A/G]
CTCTGTATCGCCGTCTTCCTCTCACCTACACGGTAGCCACACCGGACCTCCCCCCTCCCCGTCACCTCCTTCGTCGCACTGCAGACGAGAGGGACGAGGG

Reverse complement sequence

CCCTCGTCCCTCTCGTCTGCAGTGCGACGAAGGAGGTGACGGGGAGGGGGGAGGTCCGGTGTGGCTACCGTGTAGGTGAGAGGAAGACGGCGATACAGAG[T/C]
GGCAGCCATACGCCCGAGTTGGAGATGGAGGTAGCGATTGAAGGCCTAAAGGGTGAGATAATGTCAGAGGAGTGGAGCGGAGGGTGGAGAAAGCGGCAGA

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	55.90%	43.40%	0.00%	0.70%	NA
All Indica	2759	82.60%	17.30%	0.00%	0.07%	NA
All Japonica	1512	7.40%	90.50%	0.00%	2.05%	NA
Aus	269	54.30%	45.70%	0.00%	0.00%	NA
Indica I	595	50.30%	49.70%	0.00%	0.00%	NA
Indica II	465	94.80%	5.20%	0.00%	0.00%	NA
Indica III	913	95.60%	4.20%	0.00%	0.22%	NA
Indica Intermediate	786	84.70%	15.30%	0.00%	0.00%	NA
Temperate Japonica	767	5.00%	95.00%	0.00%	0.00%	NA
Tropical Japonica	504	11.30%	82.90%	0.00%	5.75%	NA
Japonica Intermediate	241	7.10%	92.10%	0.00%	0.83%	NA
VI/Aromatic	96	57.30%	42.70%	0.00%	0.00%	NA
Intermediate	90	57.80%	42.20%	0.00%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1125609610	A -> DEL	N	N	silent_mutation	Average:67.023; most accessible tissue: Zhenshan97 panicle, score: 88.35	N	N	N	N
vg1125609610	A -> G	LOC_Os11g42525.1	upstream_gene_variant ; 2175.0bp to feature; MODIFIER	silent_mutation	Average:67.023; most accessible tissue: Zhenshan97 panicle, score: 88.35	N	N	N	N
vg1125609610	A -> G	LOC_Os11g42530.1	upstream_gene_variant ; 3773.0bp to feature; MODIFIER	silent_mutation	Average:67.023; most accessible tissue: Zhenshan97 panicle, score: 88.35	N	N	N	N
vg1125609610	A -> G	LOC_Os11g42540.1	upstream_gene_variant ; 4896.0bp to feature; MODIFIER	silent_mutation	Average:67.023; most accessible tissue: Zhenshan97 panicle, score: 88.35	N	N	N	N
vg1125609610	A -> G	LOC_Os11g42540.2	upstream_gene_variant ; 4896.0bp to feature; MODIFIER	silent_mutation	Average:67.023; most accessible tissue: Zhenshan97 panicle, score: 88.35	N	N	N	N
vg1125609610	A -> G	LOC_Os11g42520.1	downstream_gene_variant ; 814.0bp to feature; MODIFIER	silent_mutation	Average:67.023; most accessible tissue: Zhenshan97 panicle, score: 88.35	N	N	N	N
vg1125609610	A -> G	LOC_Os11g42520-LOC_Os11g42525	intergenic_region ; MODIFIER	silent_mutation	Average:67.023; most accessible tissue: Zhenshan97 panicle, score: 88.35	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1125609610	NA	2.01E-06	mr1030	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125609610	1.82E-22	7.06E-27	mr1191	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125609610	4.66E-14	1.50E-11	mr1191	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125609610	1.56E-06	1.56E-06	mr1191	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125609610	4.23E-06	NA	mr1238	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125609610	NA	9.90E-06	mr1309	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125609610	NA	5.36E-06	mr1380	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125609610	NA	1.40E-06	mr1561	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125609610	NA	5.08E-10	mr1581	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125609610	1.12E-25	8.32E-28	mr1644	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125609610	2.75E-18	6.80E-13	mr1644	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125609610	1.69E-08	1.69E-08	mr1644	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125609610	NA	4.89E-06	mr1743	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125609610	NA	3.67E-11	mr1819	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125609610	1.77E-06	3.50E-13	mr1900	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125609610	NA	1.18E-06	mr1908	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125609610	NA	8.61E-06	mr1937	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125609610	3.44E-29	5.56E-33	mr1191_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125609610	2.89E-20	1.83E-13	mr1191_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125609610	7.77E-08	7.77E-08	mr1191_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125609610	NA	8.31E-06	mr1219_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251