Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923).

Detailed information for vg1125609366:

Variant ID: vg1125609366 (JBrowse)	Variation Type: SNP
Chromosome: chr11	Position: 25609366
Reference Allele: G	Alternative Allele: T,A
Primary Allele: G	Secondary Allele: T

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 1.00, others allele: 0.00, population size: 236. )

Flanking Sequence (100 bp) in Reference Genome:

TCATGGCTAATTAATGAATCCAAATAAAGTCAAAATTAATGATTTTATTTGATGCATGCATCACTACAGAACACCTAATAGAGAACTCTTCCGTCCGCTC[G/T,A]
ATCCTTCACACGGGTCTAAAATTAAAAACTCGCATCAACATAAGTGAGCCGATCGAACCGAGCCGACTAGGAGCTTCTAGAAAAGAGGAGGCCGCTACTG

Reverse complement sequence

CAGTAGCGGCCTCCTCTTTTCTAGAAGCTCCTAGTCGGCTCGGTTCGATCGGCTCACTTATGTTGATGCGAGTTTTTAATTTTAGACCCGTGTGAAGGAT[C/A,T]
GAGCGGACGGAAGAGTTCTCTATTAGGTGTTCTGTAGTGATGCATGCATCAAATAAAATCATTAATTTTGACTTTATTTGGATTCATTAATTAGCCATGA

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	84.50%	14.60%	0.06%	0.68%	A: 0.17%
All Indica	2759	76.00%	23.80%	0.07%	0.07%	A: 0.04%
All Japonica	1512	97.20%	0.70%	0.00%	1.98%	A: 0.13%
Aus	269	95.50%	3.00%	0.37%	0.00%	A: 1.12%
Indica I	595	87.20%	12.80%	0.00%	0.00%	NA
Indica II	465	86.00%	13.80%	0.22%	0.00%	NA
Indica III	913	64.40%	35.20%	0.11%	0.22%	A: 0.11%
Indica Intermediate	786	75.10%	24.90%	0.00%	0.00%	NA
Temperate Japonica	767	99.20%	0.80%	0.00%	0.00%	NA
Tropical Japonica	504	93.80%	0.40%	0.00%	5.56%	A: 0.20%
Japonica Intermediate	241	97.90%	0.80%	0.00%	0.83%	A: 0.41%
VI/Aromatic	96	97.90%	0.00%	0.00%	0.00%	A: 2.08%
Intermediate	90	85.60%	14.40%	0.00%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1125609366	G -> T	LOC_Os11g42525.1	upstream_gene_variant ; 2419.0bp to feature; MODIFIER	silent_mutation	Average:64.571; most accessible tissue: Minghui63 flower, score: 74.23	N	N	N	N
vg1125609366	G -> T	LOC_Os11g42530.1	upstream_gene_variant ; 4017.0bp to feature; MODIFIER	silent_mutation	Average:64.571; most accessible tissue: Minghui63 flower, score: 74.23	N	N	N	N
vg1125609366	G -> T	LOC_Os11g42520.1	downstream_gene_variant ; 570.0bp to feature; MODIFIER	silent_mutation	Average:64.571; most accessible tissue: Minghui63 flower, score: 74.23	N	N	N	N
vg1125609366	G -> T	LOC_Os11g42520-LOC_Os11g42525	intergenic_region ; MODIFIER	silent_mutation	Average:64.571; most accessible tissue: Minghui63 flower, score: 74.23	N	N	N	N
vg1125609366	G -> A	LOC_Os11g42525.1	upstream_gene_variant ; 2419.0bp to feature; MODIFIER	silent_mutation	Average:64.571; most accessible tissue: Minghui63 flower, score: 74.23	N	N	N	N
vg1125609366	G -> A	LOC_Os11g42530.1	upstream_gene_variant ; 4017.0bp to feature; MODIFIER	silent_mutation	Average:64.571; most accessible tissue: Minghui63 flower, score: 74.23	N	N	N	N
vg1125609366	G -> A	LOC_Os11g42520.1	downstream_gene_variant ; 570.0bp to feature; MODIFIER	silent_mutation	Average:64.571; most accessible tissue: Minghui63 flower, score: 74.23	N	N	N	N
vg1125609366	G -> A	LOC_Os11g42520-LOC_Os11g42525	intergenic_region ; MODIFIER	silent_mutation	Average:64.571; most accessible tissue: Minghui63 flower, score: 74.23	N	N	N	N
vg1125609366	G -> DEL	N	N	silent_mutation	Average:64.571; most accessible tissue: Minghui63 flower, score: 74.23	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1125609366	NA	8.64E-06	mr1063	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125609366	1.20E-07	3.23E-09	mr1662	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125609366	1.66E-07	1.51E-09	mr1662	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125609366	NA	6.86E-07	mr1133_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125609366	NA	3.75E-06	mr1662_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251