\
| Variant ID: vg1125605039 (JBrowse) | Variation Type: SNP |
| Chromosome: chr11 | Position: 25605039 |
| Reference Allele: G | Alternative Allele: A |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele: Not determined.
TTAGTCCCGGTTATTTCAACCGGGACTAAAAATTCTCATCTTGAGTCCTGGATTAAATATCCCGGTTACATGCCCGGGATTAAAGGAGGTTGCGAACCAG[G/A]
ACTCAAAATGGATTCTCCAGTAGTATACATGTTGAGAAGATTAGTGTAACATATGCCTCTGTAGATACATATCTAGAACAAGCTATGTTACTATCAAGCA
TGCTTGATAGTAACATAGCTTGTTCTAGATATGTATCTACAGAGGCATATGTTACACTAATCTTCTCAACATGTATACTACTGGAGAATCCATTTTGAGT[C/T]
CTGGTTCGCAACCTCCTTTAATCCCGGGCATGTAACCGGGATATTTAATCCAGGACTCAAGATGAGAATTTTTAGTCCCGGTTGAAATAACCGGGACTAA
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 72.10% | 27.80% | 0.08% | 0.00% | NA |
| All Indica | 2759 | 64.10% | 35.80% | 0.07% | 0.00% | NA |
| All Japonica | 1512 | 92.60% | 7.30% | 0.07% | 0.00% | NA |
| Aus | 269 | 47.20% | 52.40% | 0.37% | 0.00% | NA |
| Indica I | 595 | 91.30% | 8.40% | 0.34% | 0.00% | NA |
| Indica II | 465 | 53.80% | 46.20% | 0.00% | 0.00% | NA |
| Indica III | 913 | 55.90% | 44.10% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 59.30% | 40.70% | 0.00% | 0.00% | NA |
| Temperate Japonica | 767 | 96.90% | 3.10% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 85.70% | 14.30% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 93.40% | 6.20% | 0.41% | 0.00% | NA |
| VI/Aromatic | 96 | 44.80% | 55.20% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 77.80% | 22.20% | 0.00% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1125605039 | G -> A | LOC_Os11g42510.1 | upstream_gene_variant ; 2621.0bp to feature; MODIFIER | silent_mutation | Average:55.463; most accessible tissue: Callus, score: 83.65 | N | N | N | N |
| vg1125605039 | G -> A | LOC_Os11g42520.1 | upstream_gene_variant ; 3369.0bp to feature; MODIFIER | silent_mutation | Average:55.463; most accessible tissue: Callus, score: 83.65 | N | N | N | N |
| vg1125605039 | G -> A | LOC_Os11g42510.2 | upstream_gene_variant ; 1550.0bp to feature; MODIFIER | silent_mutation | Average:55.463; most accessible tissue: Callus, score: 83.65 | N | N | N | N |
| vg1125605039 | G -> A | LOC_Os11g42510-LOC_Os11g42520 | intergenic_region ; MODIFIER | silent_mutation | Average:55.463; most accessible tissue: Callus, score: 83.65 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1125605039 | 2.66E-10 | 2.13E-13 | mr1191 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1125605039 | 1.08E-11 | 5.33E-16 | mr1191 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1125605039 | 3.15E-11 | 1.67E-15 | mr1644 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1125605039 | 9.37E-14 | 1.44E-19 | mr1644 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1125605039 | 3.16E-11 | 3.92E-17 | mr1191_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1125605039 | 3.48E-12 | 1.25E-19 | mr1191_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |