\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1125605039:

Variant ID: vg1125605039 (JBrowse)Variation Type: SNP
Chromosome: chr11Position: 25605039
Reference Allele: GAlternative Allele: A
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


TTAGTCCCGGTTATTTCAACCGGGACTAAAAATTCTCATCTTGAGTCCTGGATTAAATATCCCGGTTACATGCCCGGGATTAAAGGAGGTTGCGAACCAG[G/A]
ACTCAAAATGGATTCTCCAGTAGTATACATGTTGAGAAGATTAGTGTAACATATGCCTCTGTAGATACATATCTAGAACAAGCTATGTTACTATCAAGCA

Reverse complement sequence

TGCTTGATAGTAACATAGCTTGTTCTAGATATGTATCTACAGAGGCATATGTTACACTAATCTTCTCAACATGTATACTACTGGAGAATCCATTTTGAGT[C/T]
CTGGTTCGCAACCTCCTTTAATCCCGGGCATGTAACCGGGATATTTAATCCAGGACTCAAGATGAGAATTTTTAGTCCCGGTTGAAATAACCGGGACTAA

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 72.10% 27.80% 0.08% 0.00% NA
All Indica  2759 64.10% 35.80% 0.07% 0.00% NA
All Japonica  1512 92.60% 7.30% 0.07% 0.00% NA
Aus  269 47.20% 52.40% 0.37% 0.00% NA
Indica I  595 91.30% 8.40% 0.34% 0.00% NA
Indica II  465 53.80% 46.20% 0.00% 0.00% NA
Indica III  913 55.90% 44.10% 0.00% 0.00% NA
Indica Intermediate  786 59.30% 40.70% 0.00% 0.00% NA
Temperate Japonica  767 96.90% 3.10% 0.00% 0.00% NA
Tropical Japonica  504 85.70% 14.30% 0.00% 0.00% NA
Japonica Intermediate  241 93.40% 6.20% 0.41% 0.00% NA
VI/Aromatic  96 44.80% 55.20% 0.00% 0.00% NA
Intermediate  90 77.80% 22.20% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1125605039 G -> A LOC_Os11g42510.1 upstream_gene_variant ; 2621.0bp to feature; MODIFIER silent_mutation Average:55.463; most accessible tissue: Callus, score: 83.65 N N N N
vg1125605039 G -> A LOC_Os11g42520.1 upstream_gene_variant ; 3369.0bp to feature; MODIFIER silent_mutation Average:55.463; most accessible tissue: Callus, score: 83.65 N N N N
vg1125605039 G -> A LOC_Os11g42510.2 upstream_gene_variant ; 1550.0bp to feature; MODIFIER silent_mutation Average:55.463; most accessible tissue: Callus, score: 83.65 N N N N
vg1125605039 G -> A LOC_Os11g42510-LOC_Os11g42520 intergenic_region ; MODIFIER silent_mutation Average:55.463; most accessible tissue: Callus, score: 83.65 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1125605039 2.66E-10 2.13E-13 mr1191 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125605039 1.08E-11 5.33E-16 mr1191 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125605039 3.15E-11 1.67E-15 mr1644 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125605039 9.37E-14 1.44E-19 mr1644 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125605039 3.16E-11 3.92E-17 mr1191_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125605039 3.48E-12 1.25E-19 mr1191_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251