\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1125604846:

Variant ID: vg1125604846 (JBrowse)Variation Type: SNP
Chromosome: chr11Position: 25604846
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.68, T: 0.32, others allele: 0.00, population size: 111. )

Flanking Sequence (100 bp) in Reference Genome:


TATCTGATCTCTGATGTCAATTTGATGTGAGGATTTGGGTATTTCAATATACAAGCAGCAAAAAACAATGAAAAAAACATCATTTAGTCTCGGTTGGTAA[C/T]
ACCAACCGGTACTAAAGATGATAGCATCAGTCACATGGTGATACCATCTTTAGTTCTAATTAGTGTTACCAACAGGGGCTAAAAATGAATCTTTAGTCCC

Reverse complement sequence

GGGACTAAAGATTCATTTTTAGCCCCTGTTGGTAACACTAATTAGAACTAAAGATGGTATCACCATGTGACTGATGCTATCATCTTTAGTACCGGTTGGT[G/A]
TTACCAACCGAGACTAAATGATGTTTTTTTCATTGTTTTTTGCTGCTTGTATATTGAAATACCCAAATCCTCACATCAAATTGACATCAGAGATCAGATA

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 66.40% 33.60% 0.06% 0.00% NA
All Indica  2759 84.20% 15.80% 0.04% 0.00% NA
All Japonica  1512 36.30% 63.70% 0.00% 0.00% NA
Aus  269 57.20% 42.80% 0.00% 0.00% NA
Indica I  595 52.80% 47.20% 0.00% 0.00% NA
Indica II  465 96.10% 3.70% 0.22% 0.00% NA
Indica III  913 97.00% 3.00% 0.00% 0.00% NA
Indica Intermediate  786 86.00% 14.00% 0.00% 0.00% NA
Temperate Japonica  767 51.60% 48.40% 0.00% 0.00% NA
Tropical Japonica  504 19.40% 80.60% 0.00% 0.00% NA
Japonica Intermediate  241 22.80% 77.20% 0.00% 0.00% NA
VI/Aromatic  96 57.30% 42.70% 0.00% 0.00% NA
Intermediate  90 62.20% 35.60% 2.22% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1125604846 C -> T LOC_Os11g42510.1 upstream_gene_variant ; 2428.0bp to feature; MODIFIER silent_mutation Average:44.263; most accessible tissue: Minghui63 panicle, score: 62.157 N N N N
vg1125604846 C -> T LOC_Os11g42520.1 upstream_gene_variant ; 3562.0bp to feature; MODIFIER silent_mutation Average:44.263; most accessible tissue: Minghui63 panicle, score: 62.157 N N N N
vg1125604846 C -> T LOC_Os11g42510.2 upstream_gene_variant ; 1357.0bp to feature; MODIFIER silent_mutation Average:44.263; most accessible tissue: Minghui63 panicle, score: 62.157 N N N N
vg1125604846 C -> T LOC_Os11g42510-LOC_Os11g42520 intergenic_region ; MODIFIER silent_mutation Average:44.263; most accessible tissue: Minghui63 panicle, score: 62.157 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1125604846 3.29E-09 9.17E-14 mr1191 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125604846 1.70E-13 4.00E-11 mr1191 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125604846 6.07E-09 6.07E-09 mr1609 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125604846 2.62E-11 9.30E-14 mr1644 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125604846 1.58E-18 6.99E-13 mr1644 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125604846 3.72E-13 5.85E-16 mr1191_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125604846 1.23E-18 1.43E-12 mr1191_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251