Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1125604846:

Variant ID: vg1125604846 (JBrowse)	Variation Type: SNP
Chromosome: chr11	Position: 25604846
Reference Allele: C	Alternative Allele: T
Primary Allele: C	Secondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.68, T: 0.32, others allele: 0.00, population size: 111. )

Flanking Sequence (100 bp) in Reference Genome:

TATCTGATCTCTGATGTCAATTTGATGTGAGGATTTGGGTATTTCAATATACAAGCAGCAAAAAACAATGAAAAAAACATCATTTAGTCTCGGTTGGTAA[C/T]
ACCAACCGGTACTAAAGATGATAGCATCAGTCACATGGTGATACCATCTTTAGTTCTAATTAGTGTTACCAACAGGGGCTAAAAATGAATCTTTAGTCCC

Reverse complement sequence

GGGACTAAAGATTCATTTTTAGCCCCTGTTGGTAACACTAATTAGAACTAAAGATGGTATCACCATGTGACTGATGCTATCATCTTTAGTACCGGTTGGT[G/A]
TTACCAACCGAGACTAAATGATGTTTTTTTCATTGTTTTTTGCTGCTTGTATATTGAAATACCCAAATCCTCACATCAAATTGACATCAGAGATCAGATA

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	66.40%	33.60%	0.06%	0.00%	NA
All Indica	2759	84.20%	15.80%	0.04%	0.00%	NA
All Japonica	1512	36.30%	63.70%	0.00%	0.00%	NA
Aus	269	57.20%	42.80%	0.00%	0.00%	NA
Indica I	595	52.80%	47.20%	0.00%	0.00%	NA
Indica II	465	96.10%	3.70%	0.22%	0.00%	NA
Indica III	913	97.00%	3.00%	0.00%	0.00%	NA
Indica Intermediate	786	86.00%	14.00%	0.00%	0.00%	NA
Temperate Japonica	767	51.60%	48.40%	0.00%	0.00%	NA
Tropical Japonica	504	19.40%	80.60%	0.00%	0.00%	NA
Japonica Intermediate	241	22.80%	77.20%	0.00%	0.00%	NA
VI/Aromatic	96	57.30%	42.70%	0.00%	0.00%	NA
Intermediate	90	62.20%	35.60%	2.22%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1125604846	C -> T	LOC_Os11g42510.1	upstream_gene_variant ; 2428.0bp to feature; MODIFIER	silent_mutation	Average:44.263; most accessible tissue: Minghui63 panicle, score: 62.157	N	N	N	N
vg1125604846	C -> T	LOC_Os11g42520.1	upstream_gene_variant ; 3562.0bp to feature; MODIFIER	silent_mutation	Average:44.263; most accessible tissue: Minghui63 panicle, score: 62.157	N	N	N	N
vg1125604846	C -> T	LOC_Os11g42510.2	upstream_gene_variant ; 1357.0bp to feature; MODIFIER	silent_mutation	Average:44.263; most accessible tissue: Minghui63 panicle, score: 62.157	N	N	N	N
vg1125604846	C -> T	LOC_Os11g42510-LOC_Os11g42520	intergenic_region ; MODIFIER	silent_mutation	Average:44.263; most accessible tissue: Minghui63 panicle, score: 62.157	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1125604846	3.29E-09	9.17E-14	mr1191	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125604846	1.70E-13	4.00E-11	mr1191	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125604846	6.07E-09	6.07E-09	mr1609	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125604846	2.62E-11	9.30E-14	mr1644	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125604846	1.58E-18	6.99E-13	mr1644	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125604846	3.72E-13	5.85E-16	mr1191_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125604846	1.23E-18	1.43E-12	mr1191_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251