\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1125603546:

Variant ID: vg1125603546 (JBrowse)Variation Type: SNP
Chromosome: chr11Position: 25603546
Reference Allele: TAlternative Allele: C
Primary Allele: TSecondary Allele: C

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.54, C: 0.46, others allele: 0.00, population size: 96. )

Flanking Sequence (100 bp) in Reference Genome:


TAAATTGGAGGAGTACCTTTTTTTATGACACTTTTGGAATCCATTGCTGACAAATATTTATAAATGAATGATATTATGACATCGATATCGAGAACTGTCA[T/C]
GTTTTATAGTGTAAATTTTGATACCTTTTAAAATCTAATGTATCGTGAGGTACCAAATTTACGAATGGTAATATAGTCCATAAATTATTTTCGCAATGTG

Reverse complement sequence

CACATTGCGAAAATAATTTATGGACTATATTACCATTCGTAAATTTGGTACCTCACGATACATTAGATTTTAAAAGGTATCAAAATTTACACTATAAAAC[A/G]
TGACAGTTCTCGATATCGATGTCATAATATCATTCATTTATAAATATTTGTCAGCAATGGATTCCAAAAGTGTCATAAAAAAAGGTACTCCTCCAATTTA

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 62.60% 37.20% 0.25% 0.00% NA
All Indica  2759 49.10% 50.50% 0.36% 0.00% NA
All Japonica  1512 89.90% 10.10% 0.00% 0.00% NA
Aus  269 49.80% 50.20% 0.00% 0.00% NA
Indica I  595 89.60% 9.90% 0.50% 0.00% NA
Indica II  465 41.70% 57.40% 0.86% 0.00% NA
Indica III  913 30.20% 69.70% 0.11% 0.00% NA
Indica Intermediate  786 44.90% 54.80% 0.25% 0.00% NA
Temperate Japonica  767 93.40% 6.60% 0.00% 0.00% NA
Tropical Japonica  504 83.30% 16.70% 0.00% 0.00% NA
Japonica Intermediate  241 92.50% 7.50% 0.00% 0.00% NA
VI/Aromatic  96 44.80% 55.20% 0.00% 0.00% NA
Intermediate  90 72.20% 25.60% 2.22% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1125603546 T -> C LOC_Os11g42510.1 upstream_gene_variant ; 1128.0bp to feature; MODIFIER silent_mutation Average:59.58; most accessible tissue: Callus, score: 85.361 N N N N
vg1125603546 T -> C LOC_Os11g42520.1 upstream_gene_variant ; 4862.0bp to feature; MODIFIER silent_mutation Average:59.58; most accessible tissue: Callus, score: 85.361 N N N N
vg1125603546 T -> C LOC_Os11g42510.2 upstream_gene_variant ; 57.0bp to feature; MODIFIER silent_mutation Average:59.58; most accessible tissue: Callus, score: 85.361 N N N N
vg1125603546 T -> C LOC_Os11g42510-LOC_Os11g42520 intergenic_region ; MODIFIER silent_mutation Average:59.58; most accessible tissue: Callus, score: 85.361 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1125603546 4.42E-07 3.92E-07 mr1133 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125603546 NA 1.60E-07 mr1496 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125603546 5.90E-06 5.90E-06 mr1644 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125603546 NA 3.10E-06 mr1662 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125603546 NA 3.20E-08 mr1904 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125603546 1.69E-06 8.58E-09 mr1133_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125603546 1.71E-09 1.71E-09 mr1191_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125603546 NA 6.21E-07 mr1496_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125603546 NA 1.05E-06 mr1662_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125603546 NA 2.21E-06 mr1667_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251