\
| Variant ID: vg1125603546 (JBrowse) | Variation Type: SNP |
| Chromosome: chr11 | Position: 25603546 |
| Reference Allele: T | Alternative Allele: C |
| Primary Allele: T | Secondary Allele: C |
Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.54, C: 0.46, others allele: 0.00, population size: 96. )
TAAATTGGAGGAGTACCTTTTTTTATGACACTTTTGGAATCCATTGCTGACAAATATTTATAAATGAATGATATTATGACATCGATATCGAGAACTGTCA[T/C]
GTTTTATAGTGTAAATTTTGATACCTTTTAAAATCTAATGTATCGTGAGGTACCAAATTTACGAATGGTAATATAGTCCATAAATTATTTTCGCAATGTG
CACATTGCGAAAATAATTTATGGACTATATTACCATTCGTAAATTTGGTACCTCACGATACATTAGATTTTAAAAGGTATCAAAATTTACACTATAAAAC[A/G]
TGACAGTTCTCGATATCGATGTCATAATATCATTCATTTATAAATATTTGTCAGCAATGGATTCCAAAAGTGTCATAAAAAAAGGTACTCCTCCAATTTA
| Populations | Population Size | Frequency of T(primary allele) | Frequency of C(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 62.60% | 37.20% | 0.25% | 0.00% | NA |
| All Indica | 2759 | 49.10% | 50.50% | 0.36% | 0.00% | NA |
| All Japonica | 1512 | 89.90% | 10.10% | 0.00% | 0.00% | NA |
| Aus | 269 | 49.80% | 50.20% | 0.00% | 0.00% | NA |
| Indica I | 595 | 89.60% | 9.90% | 0.50% | 0.00% | NA |
| Indica II | 465 | 41.70% | 57.40% | 0.86% | 0.00% | NA |
| Indica III | 913 | 30.20% | 69.70% | 0.11% | 0.00% | NA |
| Indica Intermediate | 786 | 44.90% | 54.80% | 0.25% | 0.00% | NA |
| Temperate Japonica | 767 | 93.40% | 6.60% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 83.30% | 16.70% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 92.50% | 7.50% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 44.80% | 55.20% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 72.20% | 25.60% | 2.22% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1125603546 | T -> C | LOC_Os11g42510.1 | upstream_gene_variant ; 1128.0bp to feature; MODIFIER | silent_mutation | Average:59.58; most accessible tissue: Callus, score: 85.361 | N | N | N | N |
| vg1125603546 | T -> C | LOC_Os11g42520.1 | upstream_gene_variant ; 4862.0bp to feature; MODIFIER | silent_mutation | Average:59.58; most accessible tissue: Callus, score: 85.361 | N | N | N | N |
| vg1125603546 | T -> C | LOC_Os11g42510.2 | upstream_gene_variant ; 57.0bp to feature; MODIFIER | silent_mutation | Average:59.58; most accessible tissue: Callus, score: 85.361 | N | N | N | N |
| vg1125603546 | T -> C | LOC_Os11g42510-LOC_Os11g42520 | intergenic_region ; MODIFIER | silent_mutation | Average:59.58; most accessible tissue: Callus, score: 85.361 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1125603546 | 4.42E-07 | 3.92E-07 | mr1133 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1125603546 | NA | 1.60E-07 | mr1496 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1125603546 | 5.90E-06 | 5.90E-06 | mr1644 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1125603546 | NA | 3.10E-06 | mr1662 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1125603546 | NA | 3.20E-08 | mr1904 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1125603546 | 1.69E-06 | 8.58E-09 | mr1133_2 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1125603546 | 1.71E-09 | 1.71E-09 | mr1191_2 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1125603546 | NA | 6.21E-07 | mr1496_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1125603546 | NA | 1.05E-06 | mr1662_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1125603546 | NA | 2.21E-06 | mr1667_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |