Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1125603056:

Variant ID: vg1125603056 (JBrowse)Variation Type: SNP
Chromosome: chr11Position: 25603056
Reference Allele: GAlternative Allele: A
Primary Allele: ASecondary Allele: G

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.53, G: 0.47, others allele: 0.00, population size: 108. )

Flanking Sequence (100 bp) in Reference Genome:


AAAAGCCAACAGGGGCACGCATGTCGTGTCAGGAGATAGAGCTCACAGCTCAGGATCGCCGCGAGATAATACACTCATTTTTTTTTTCTTTTTTTTTTTT[G/A]
GCTTCGTTGCTGATGTATTTCTTTTGTTTTTGGGCGTGTTCGCCTGGTCTATACTAGTAGCTGCCGCAGTGGCTGCGGTTGCGACAGTCCAAACCGGCTG

Reverse complement sequence

CAGCCGGTTTGGACTGTCGCAACCGCAGCCACTGCGGCAGCTACTAGTATAGACCAGGCGAACACGCCCAAAAACAAAAGAAATACATCAGCAACGAAGC[C/T]
AAAAAAAAAAAAGAAAAAAAAAATGAGTGTATTATCTCGCGGCGATCCTGAGCTGTGAGCTCTATCTCCTGACACGACATGCGTGCCCCTGTTGGCTTTT

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 67.10% 32.60% 0.30% 0.00% NA
All Indica  2759 78.00% 21.90% 0.11% 0.00% NA
All Japonica  1512 47.30% 52.40% 0.26% 0.00% NA
Aus  269 69.50% 28.60% 1.86% 0.00% NA
Indica I  595 50.40% 49.60% 0.00% 0.00% NA
Indica II  465 94.20% 5.40% 0.43% 0.00% NA
Indica III  913 83.80% 16.20% 0.00% 0.00% NA
Indica Intermediate  786 82.60% 17.30% 0.13% 0.00% NA
Temperate Japonica  767 25.40% 74.20% 0.39% 0.00% NA
Tropical Japonica  504 79.00% 21.00% 0.00% 0.00% NA
Japonica Intermediate  241 50.60% 49.00% 0.41% 0.00% NA
VI/Aromatic  96 56.20% 43.80% 0.00% 0.00% NA
Intermediate  90 72.20% 25.60% 2.22% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1125603056 G -> A LOC_Os11g42510.1 upstream_gene_variant ; 638.0bp to feature; MODIFIER silent_mutation Average:96.658; most accessible tissue: Callus, score: 99.308 N N N N
vg1125603056 G -> A LOC_Os11g42510.2 intron_variant ; MODIFIER silent_mutation Average:96.658; most accessible tissue: Callus, score: 99.308 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg1125603056 G A -0.09 -0.07 -0.04 0.01 -0.05 -0.08

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1125603056 NA 1.86E-06 mr1030 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125603056 NA 3.17E-06 mr1060 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125603056 2.41E-09 1.75E-11 mr1191 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125603056 2.52E-11 1.22E-08 mr1191 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125603056 NA 6.24E-06 mr1378 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125603056 NA 9.93E-07 mr1380 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125603056 NA 3.50E-07 mr1614 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125603056 8.30E-12 2.82E-14 mr1644 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125603056 8.75E-16 1.17E-10 mr1644 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125603056 NA 3.87E-06 mr1743 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125603056 NA 5.02E-08 mr1937 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125603056 NA 7.67E-06 mr1161_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125603056 1.08E-11 2.44E-14 mr1191_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125603056 4.07E-17 2.42E-10 mr1191_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251