\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1125580754:

Variant ID: vg1125580754 (JBrowse)Variation Type: SNP
Chromosome: chr11Position: 25580754
Reference Allele: GAlternative Allele: A
Primary Allele: ASecondary Allele: G

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.67, A: 0.33, others allele: 0.00, population size: 109. )

Flanking Sequence (100 bp) in Reference Genome:


GTGTAGAAGCTGGTTTTGGTGCAGTCCCCTTTTGAATTGGAACATGAAAAGAGGATGTTTTGGTACAGCCACCTCTTGAATTAAAACATGAAAAGACATG[G/A]
ACATGAAAAGACATTGGAAGAGCTGAGCTACCATGTTGAACATAAACAAAGCTATATTATGAATAAGTCACATATGGTCTAAAGATTTAGAAGGCAAGTT

Reverse complement sequence

AACTTGCCTTCTAAATCTTTAGACCATATGTGACTTATTCATAATATAGCTTTGTTTATGTTCAACATGGTAGCTCAGCTCTTCCAATGTCTTTTCATGT[C/T]
CATGTCTTTTCATGTTTTAATTCAAGAGGTGGCTGTACCAAAACATCCTCTTTTCATGTTCCAATTCAAAAGGGGACTGCACCAAAACCAGCTTCTACAC

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 52.50% 47.40% 0.13% 0.00% NA
All Indica  2759 55.60% 44.30% 0.14% 0.00% NA
All Japonica  1512 45.60% 54.30% 0.07% 0.00% NA
Aus  269 61.30% 38.70% 0.00% 0.00% NA
Indica I  595 43.20% 56.60% 0.17% 0.00% NA
Indica II  465 38.90% 61.10% 0.00% 0.00% NA
Indica III  913 71.60% 28.30% 0.11% 0.00% NA
Indica Intermediate  786 56.10% 43.60% 0.25% 0.00% NA
Temperate Japonica  767 21.50% 78.50% 0.00% 0.00% NA
Tropical Japonica  504 81.00% 19.00% 0.00% 0.00% NA
Japonica Intermediate  241 48.50% 51.00% 0.41% 0.00% NA
VI/Aromatic  96 55.20% 44.80% 0.00% 0.00% NA
Intermediate  90 45.60% 53.30% 1.11% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1125580754 G -> A LOC_Os11g42470.1 upstream_gene_variant ; 1556.0bp to feature; MODIFIER silent_mutation Average:43.77; most accessible tissue: Callus, score: 92.236 N N N N
vg1125580754 G -> A LOC_Os11g42480.1 downstream_gene_variant ; 3210.0bp to feature; MODIFIER silent_mutation Average:43.77; most accessible tissue: Callus, score: 92.236 N N N N
vg1125580754 G -> A LOC_Os11g42450-LOC_Os11g42470 intergenic_region ; MODIFIER silent_mutation Average:43.77; most accessible tissue: Callus, score: 92.236 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1125580754 1.33E-07 7.00E-10 mr1133 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125580754 1.09E-19 1.20E-23 mr1191 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125580754 4.35E-20 3.46E-22 mr1191 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125580754 NA 5.63E-07 mr1380 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125580754 NA 8.79E-07 mr1561 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125580754 NA 9.33E-07 mr1561 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125580754 3.87E-23 1.55E-32 mr1644 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125580754 1.18E-23 1.04E-27 mr1644 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125580754 NA 2.47E-06 mr1667 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125580754 NA 8.00E-07 mr1908 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125580754 NA 1.53E-06 mr1937 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125580754 NA 2.01E-07 mr1133_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125580754 2.04E-22 1.21E-32 mr1191_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125580754 4.46E-26 2.32E-31 mr1191_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125580754 NA 9.38E-08 mr1380_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125580754 NA 1.46E-08 mr1380_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125580754 NA 1.19E-07 mr1561_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125580754 NA 2.37E-08 mr1561_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125580754 NA 6.29E-06 mr1667_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125580754 NA 1.62E-06 mr1875_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125580754 NA 1.48E-06 mr1908_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125580754 NA 2.96E-07 mr1996_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125580754 NA 6.37E-07 mr1996_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251