\
| Variant ID: vg1125569375 (JBrowse) | Variation Type: SNP |
| Chromosome: chr11 | Position: 25569375 |
| Reference Allele: C | Alternative Allele: T |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.98, T: 0.01, others allele: 0.00, population size: 245. )
ATAAGCACACTACTACCCCTTATATTTCTTTTTGTTACACTTCGATAGCCATATGCTACATAGTGATAGTCATACGATAAACCAAAAAGATCTTGCTACA[C/T]
GGGAAAAAAATATTCGATGCTCCTGTCGTTTTCTGTCTGTTCTTTTTTTTTTCACACAAGCTGGAGCTTTGGCCAAACTGCAATGGGCTGGGCTAGCTTA
TAAGCTAGCCCAGCCCATTGCAGTTTGGCCAAAGCTCCAGCTTGTGTGAAAAAAAAAAGAACAGACAGAAAACGACAGGAGCATCGAATATTTTTTTCCC[G/A]
TGTAGCAAGATCTTTTTGGTTTATCGTATGACTATCACTATGTAGCATATGGCTATCGAAGTGTAACAAAAAGAAATATAAGGGGTAGTAGTGTGCTTAT
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 84.80% | 11.60% | 0.17% | 3.45% | NA |
| All Indica | 2759 | 79.30% | 16.00% | 0.25% | 4.49% | NA |
| All Japonica | 1512 | 98.50% | 1.40% | 0.00% | 0.13% | NA |
| Aus | 269 | 77.00% | 9.30% | 0.37% | 13.38% | NA |
| Indica I | 595 | 97.50% | 2.40% | 0.00% | 0.17% | NA |
| Indica II | 465 | 81.30% | 17.80% | 0.22% | 0.65% | NA |
| Indica III | 913 | 66.00% | 21.10% | 0.44% | 12.38% | NA |
| Indica Intermediate | 786 | 79.60% | 19.20% | 0.25% | 0.89% | NA |
| Temperate Japonica | 767 | 98.30% | 1.70% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 99.20% | 0.40% | 0.00% | 0.40% | NA |
| Japonica Intermediate | 241 | 97.50% | 2.50% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 44.80% | 55.20% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 90.00% | 8.90% | 0.00% | 1.11% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1125569375 | C -> T | LOC_Os11g42450-LOC_Os11g42470 | intergenic_region ; MODIFIER | silent_mutation | Average:54.553; most accessible tissue: Minghui63 root, score: 70.803 | N | N | N | N |
| vg1125569375 | C -> DEL | N | N | silent_mutation | Average:54.553; most accessible tissue: Minghui63 root, score: 70.803 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1125569375 | 5.97E-16 | 2.71E-18 | mr1191 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1125569375 | 1.25E-10 | 8.76E-11 | mr1191 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1125569375 | 1.40E-19 | 9.81E-25 | mr1644 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1125569375 | 5.44E-13 | 7.71E-14 | mr1644 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1125569375 | NA | 2.65E-08 | mr1829 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1125569375 | NA | 1.42E-06 | mr1133_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1125569375 | 5.81E-22 | 1.67E-20 | mr1191_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1125569375 | 1.62E-11 | 8.56E-11 | mr1191_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1125569375 | NA | 1.76E-08 | mr1829_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |