\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1125567949:

Variant ID: vg1125567949 (JBrowse)Variation Type: SNP
Chromosome: chr11Position: 25567949
Reference Allele: TAlternative Allele: C
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 1.00, others allele: 0.00, population size: 295. )

Flanking Sequence (100 bp) in Reference Genome:


TTTCAACATATAAACGCGTTATCTTGACTGGAATTATAGGAGGATTAGTCGAACCCGTTGTTATTGTCGCAGCCTAAAAAGGCATCGATCCCCAGGCACC[T/C]
GAGGAGAACACAAAGAGAGGCACACACAGCGCAAGCAATGCGTGACGCAGCAACATGCCCTAGAGAGATACATACGCACCCACAATAGGAGAAGTTTAAG

Reverse complement sequence

CTTAAACTTCTCCTATTGTGGGTGCGTATGTATCTCTCTAGGGCATGTTGCTGCGTCACGCATTGCTTGCGCTGTGTGTGCCTCTCTTTGTGTTCTCCTC[A/G]
GGTGCCTGGGGATCGATGCCTTTTTAGGCTGCGACAATAACAACGGGTTCGACTAATCCTCCTATAATTCCAGTCAAGATAACGCGTTTATATGTTGAAA

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 50.80% 49.20% 0.00% 0.00% NA
All Indica  2759 57.80% 42.20% 0.00% 0.00% NA
All Japonica  1512 32.90% 67.10% 0.00% 0.00% NA
Aus  269 78.40% 21.60% 0.00% 0.00% NA
Indica I  595 17.30% 82.70% 0.00% 0.00% NA
Indica II  465 24.70% 75.30% 0.00% 0.00% NA
Indica III  913 96.50% 3.50% 0.00% 0.00% NA
Indica Intermediate  786 63.10% 36.90% 0.00% 0.00% NA
Temperate Japonica  767 36.90% 63.10% 0.00% 0.00% NA
Tropical Japonica  504 28.80% 71.20% 0.00% 0.00% NA
Japonica Intermediate  241 28.60% 71.40% 0.00% 0.00% NA
VI/Aromatic  96 56.20% 43.80% 0.00% 0.00% NA
Intermediate  90 51.10% 48.90% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1125567949 T -> C LOC_Os11g42450-LOC_Os11g42470 intergenic_region ; MODIFIER silent_mutation Average:58.008; most accessible tissue: Callus, score: 90.815 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1125567949 NA 1.01E-09 Heading_date Ind_All Not Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg1125567949 6.60E-06 8.65E-12 mr1063 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125567949 9.31E-08 NA mr1133 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125567949 5.30E-15 5.11E-28 mr1133 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125567949 NA 4.28E-06 mr1242 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125567949 NA 6.44E-07 mr1533 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125567949 4.02E-07 4.03E-07 mr1540 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125567949 3.75E-07 3.06E-11 mr1662 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125567949 6.14E-07 NA mr1667 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125567949 2.24E-09 2.70E-15 mr1667 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125567949 4.60E-07 1.63E-07 mr1732 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125567949 NA 7.57E-07 mr1870 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125567949 NA 5.64E-07 mr1980 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125567949 NA 7.94E-09 mr1063_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125567949 1.70E-07 1.33E-14 mr1133_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125567949 1.32E-13 2.87E-27 mr1133_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125567949 NA 1.58E-06 mr1242_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125567949 6.00E-06 2.40E-09 mr1662_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125567949 5.30E-07 1.83E-10 mr1667_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125567949 4.92E-10 4.60E-17 mr1667_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251