\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1125548017:

Variant ID: vg1125548017 (JBrowse)Variation Type: SNP
Chromosome: chr11Position: 25548017
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.80, T: 0.20, others allele: 0.00, population size: 168. )

Flanking Sequence (100 bp) in Reference Genome:


GCGTTCTATGGAAAGGGAAGGTTCATATATCGAAAGACCATAAATTACATCTAGAGCAGCAGCTTGAATTAAGGCAGTGTTTAGATCCAAAGTTTGGATC[C/T]
AAACTTCAGTCCTTTTTCATCACATACACACACAACTTTTCAGTCACATCATCTCCAATTTCAACCAAAATCCAAACTTTACACTGAAAGCTTCAAAGCT

Reverse complement sequence

AGCTTTGAAGCTTTCAGTGTAAAGTTTGGATTTTGGTTGAAATTGGAGATGATGTGACTGAAAAGTTGTGTGTGTATGTGATGAAAAAGGACTGAAGTTT[G/A]
GATCCAAACTTTGGATCTAAACACTGCCTTAATTCAAGCTGCTGCTCTAGATGTAATTTATGGTCTTTCGATATATGAACCTTCCCTTTCCATAGAACGC

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 61.00% 39.00% 0.08% 0.00% NA
All Indica  2759 45.10% 54.80% 0.11% 0.00% NA
All Japonica  1512 88.70% 11.30% 0.00% 0.00% NA
Aus  269 51.70% 48.30% 0.00% 0.00% NA
Indica I  595 84.40% 15.60% 0.00% 0.00% NA
Indica II  465 77.00% 23.00% 0.00% 0.00% NA
Indica III  913 8.30% 91.60% 0.11% 0.00% NA
Indica Intermediate  786 39.10% 60.70% 0.25% 0.00% NA
Temperate Japonica  767 96.90% 3.10% 0.00% 0.00% NA
Tropical Japonica  504 74.20% 25.80% 0.00% 0.00% NA
Japonica Intermediate  241 92.90% 7.10% 0.00% 0.00% NA
VI/Aromatic  96 100.00% 0.00% 0.00% 0.00% NA
Intermediate  90 68.90% 30.00% 1.11% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1125548017 C -> T LOC_Os11g42450.1 upstream_gene_variant ; 4095.0bp to feature; MODIFIER silent_mutation Average:43.242; most accessible tissue: Callus, score: 81.554 N N N N
vg1125548017 C -> T LOC_Os11g42440.1 downstream_gene_variant ; 482.0bp to feature; MODIFIER silent_mutation Average:43.242; most accessible tissue: Callus, score: 81.554 N N N N
vg1125548017 C -> T LOC_Os11g42440-LOC_Os11g42450 intergenic_region ; MODIFIER silent_mutation Average:43.242; most accessible tissue: Callus, score: 81.554 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1125548017 NA 5.88E-10 mr1063 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125548017 2.50E-14 1.43E-39 mr1133 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125548017 3.26E-16 5.07E-31 mr1133 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125548017 NA 2.04E-06 mr1242 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125548017 NA 6.20E-06 mr1484 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125548017 NA 3.77E-07 mr1533 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125548017 4.39E-06 NA mr1540 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125548017 6.42E-07 6.42E-07 mr1540 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125548017 1.21E-08 1.78E-08 mr1662 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125548017 1.73E-08 1.42E-12 mr1662 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125548017 7.09E-12 3.51E-23 mr1667 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125548017 1.32E-10 5.43E-17 mr1667 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125548017 4.49E-06 8.08E-07 mr1732 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125548017 NA 7.73E-07 mr1870 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125548017 NA 7.05E-06 mr1925 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125548017 NA 7.42E-08 mr1980 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125548017 NA 8.61E-07 mr1063_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125548017 3.37E-14 8.52E-34 mr1133_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125548017 6.72E-14 9.07E-29 mr1133_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125548017 NA 9.90E-07 mr1242_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125548017 4.79E-07 2.17E-07 mr1662_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125548017 1.08E-06 2.22E-10 mr1662_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125548017 1.30E-09 4.48E-19 mr1667_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125548017 9.08E-11 2.22E-18 mr1667_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251