\
| Variant ID: vg1125546169 (JBrowse) | Variation Type: SNP |
| Chromosome: chr11 | Position: 25546169 |
| Reference Allele: C | Alternative Allele: G |
| Primary Allele: G | Secondary Allele: C |
Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.94, C: 0.06, others allele: 0.00, population size: 94. )
AACATCGGTACTTTCACGTGCAGACGTTACAACCACACGTGAAAACCTATTTCGTAGGTAGACTTTCTAAGGAGGCCGCTTGTAAAAACCAATTTTTTAA[C/G]
CGGCCAAGGCTAGACTGCAATGATTTTTTTCAAAAAGAAAGGACAAATCCAAAACCCTAACCAGGATCGCCGTGAGGCCGTCGACATCACGTGGTCGAGG
CCTCGACCACGTGATGTCGACGGCCTCACGGCGATCCTGGTTAGGGTTTTGGATTTGTCCTTTCTTTTTGAAAAAAATCATTGCAGTCTAGCCTTGGCCG[G/C]
TTAAAAAATTGGTTTTTACAAGCGGCCTCCTTAGAAAGTCTACCTACGAAATAGGTTTTCACGTGTGGTTGTAACGTCTGCACGTGAAAGTACCGATGTT
| Populations | Population Size | Frequency of G(primary allele) | Frequency of C(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 57.40% | 42.30% | 0.36% | 0.00% | NA |
| All Indica | 2759 | 55.40% | 44.40% | 0.14% | 0.00% | NA |
| All Japonica | 1512 | 65.70% | 33.50% | 0.73% | 0.00% | NA |
| Aus | 269 | 50.90% | 48.70% | 0.37% | 0.00% | NA |
| Indica I | 595 | 16.00% | 83.90% | 0.17% | 0.00% | NA |
| Indica II | 465 | 24.70% | 75.30% | 0.00% | 0.00% | NA |
| Indica III | 913 | 91.60% | 8.20% | 0.22% | 0.00% | NA |
| Indica Intermediate | 786 | 61.50% | 38.40% | 0.13% | 0.00% | NA |
| Temperate Japonica | 767 | 51.50% | 48.50% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 90.50% | 8.90% | 0.60% | 0.00% | NA |
| Japonica Intermediate | 241 | 59.30% | 37.30% | 3.32% | 0.00% | NA |
| VI/Aromatic | 96 | 1.00% | 99.00% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 55.60% | 43.30% | 1.11% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1125546169 | C -> G | LOC_Os11g42440.1 | intron_variant ; MODIFIER | silent_mutation | Average:61.816; most accessible tissue: Minghui63 panicle, score: 84.005 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1125546169 | NA | 8.76E-10 | Heading_date | Ind_All | Not | Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652 |
| vg1125546169 | NA | 6.31E-10 | mr1063 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1125546169 | 2.62E-13 | 1.36E-26 | mr1133 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1125546169 | NA | 2.94E-06 | mr1533 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1125546169 | 1.44E-06 | 1.44E-06 | mr1540 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1125546169 | 6.67E-08 | 2.22E-14 | mr1662 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1125546169 | 1.19E-08 | 8.47E-13 | mr1662 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1125546169 | 8.55E-06 | NA | mr1667 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1125546169 | 7.77E-09 | 8.00E-15 | mr1667 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1125546169 | 8.12E-06 | 1.80E-06 | mr1732 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1125546169 | NA | 5.11E-07 | mr1870 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1125546169 | NA | 4.67E-07 | mr1980 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1125546169 | NA | 2.61E-07 | mr1063_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1125546169 | 1.73E-12 | 9.13E-26 | mr1133_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1125546169 | NA | 2.28E-06 | mr1242_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1125546169 | 1.59E-09 | 1.25E-17 | mr1662_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1125546169 | 3.42E-07 | 6.90E-11 | mr1662_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1125546169 | 1.08E-09 | 2.00E-16 | mr1667_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |