\
| Variant ID: vg1125545020 (JBrowse) | Variation Type: SNP |
| Chromosome: chr11 | Position: 25545020 |
| Reference Allele: T | Alternative Allele: C |
| Primary Allele: T | Secondary Allele: C |
Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.83, C: 0.17, others allele: 0.00, population size: 109. )
CGTAAAGTACTTTGGATAATAAAGTAGGTCCCAAAAAAGTAAATAATAATCCCAAAATTTTTTGAATAAGACGAGTGGTCAAAAAGTGTAAGCAAAAACT[T/C]
AAAATCCCTTATATTATGGGACGGAGGGAGTACTTTCTTAGCCTTAGGCCATCCTAAATATCATCTAACTATGTTACATTATGGTCAAATATTTTCTAGT
ACTAGAAAATATTTGACCATAATGTAACATAGTTAGATGATATTTAGGATGGCCTAAGGCTAAGAAAGTACTCCCTCCGTCCCATAATATAAGGGATTTT[A/G]
AGTTTTTGCTTACACTTTTTGACCACTCGTCTTATTCAAAAAATTTTGGGATTATTATTTACTTTTTTGGGACCTACTTTATTATCCAAAGTACTTTACG
| Populations | Population Size | Frequency of T(primary allele) | Frequency of C(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 59.80% | 40.10% | 0.11% | 0.00% | NA |
| All Indica | 2759 | 47.50% | 52.30% | 0.18% | 0.00% | NA |
| All Japonica | 1512 | 88.10% | 11.90% | 0.00% | 0.00% | NA |
| Aus | 269 | 36.10% | 63.90% | 0.00% | 0.00% | NA |
| Indica I | 595 | 57.00% | 42.90% | 0.17% | 0.00% | NA |
| Indica II | 465 | 58.50% | 41.10% | 0.43% | 0.00% | NA |
| Indica III | 913 | 31.70% | 68.20% | 0.11% | 0.00% | NA |
| Indica Intermediate | 786 | 52.20% | 47.70% | 0.13% | 0.00% | NA |
| Temperate Japonica | 767 | 96.50% | 3.50% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 73.80% | 26.20% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 91.30% | 8.70% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 44.80% | 55.20% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 50.00% | 50.00% | 0.00% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1125545020 | T -> C | LOC_Os11g42430.1 | upstream_gene_variant ; 4568.0bp to feature; MODIFIER | silent_mutation | Average:34.428; most accessible tissue: Callus, score: 57.732 | N | N | N | N |
| vg1125545020 | T -> C | LOC_Os11g42440.1 | intron_variant ; MODIFIER | silent_mutation | Average:34.428; most accessible tissue: Callus, score: 57.732 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1125545020 | 2.74E-34 | 2.01E-50 | mr1191 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1125545020 | 1.84E-29 | 3.03E-40 | mr1191 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1125545020 | 7.84E-06 | NA | mr1238 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1125545020 | 1.96E-07 | 3.49E-06 | mr1238 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1125545020 | 4.36E-06 | 1.31E-06 | mr1309 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1125545020 | 9.72E-07 | 1.38E-07 | mr1484 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1125545020 | NA | 4.89E-07 | mr1561 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1125545020 | NA | 7.03E-06 | mr1561 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1125545020 | 3.01E-47 | 1.09E-70 | mr1644 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1125545020 | 1.74E-42 | 7.10E-59 | mr1644 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1125545020 | 9.93E-07 | 9.93E-07 | mr1644 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1125545020 | 4.44E-06 | 3.80E-06 | mr1841 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1125545020 | NA | 7.96E-06 | mr1908 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1125545020 | NA | 1.20E-06 | mr1925 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1125545020 | 8.19E-48 | 1.38E-70 | mr1191_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1125545020 | 8.86E-40 | 7.11E-59 | mr1191_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1125545020 | 7.12E-06 | 7.12E-06 | mr1191_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1125545020 | 3.01E-06 | NA | mr1238_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1125545020 | 4.06E-06 | NA | mr1238_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1125545020 | NA | 6.11E-06 | mr1561_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1125545020 | 3.54E-06 | 4.59E-06 | mr1841_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1125545020 | NA | 8.81E-06 | mr1908_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |