\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1125501745:

Variant ID: vg1125501745 (JBrowse)Variation Type: SNP
Chromosome: chr11Position: 25501745
Reference Allele: AAlternative Allele: T
Primary Allele: ASecondary Allele: T

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.97, T: 0.03, others allele: 0.00, population size: 112. )

Flanking Sequence (100 bp) in Reference Genome:


GATGCTGAAGCCGGCGCCGACGCCGACGCCGCACCCGCTCGCCGGCGAGAAGGTTCCCCTCACCGCCTTTGACCGCGCGGCCTTCGACGTCTTCGTCCCC[A/T]
TGGTGTTCGCCTACCGCGCGCCGGCGCCGTCCAGCGAGGCGGTCAAGGAAGGCCTCCGGATGGCCGTCGCCGCGTACCCTCTCGCCGCTGGCCGCCTCGC

Reverse complement sequence

GCGAGGCGGCCAGCGGCGAGAGGGTACGCGGCGACGGCCATCCGGAGGCCTTCCTTGACCGCCTCGCTGGACGGCGCCGGCGCGCGGTAGGCGAACACCA[T/A]
GGGGACGAAGACGTCGAAGGCCGCGCGGTCAAAGGCGGTGAGGGGAACCTTCTCGCCGGCGAGCGGGTGCGGCGTCGGCGTCGGCGCCGGCTTCAGCATC

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 64.70% 1.50% 20.84% 12.97% NA
All Indica  2759 48.30% 1.10% 30.41% 20.19% NA
All Japonica  1512 88.20% 0.30% 8.53% 3.04% NA
Aus  269 85.90% 11.50% 2.23% 0.37% NA
Indica I  595 87.70% 0.30% 4.03% 7.90% NA
Indica II  465 78.70% 0.90% 8.39% 12.04% NA
Indica III  913 9.70% 2.00% 62.21% 26.07% NA
Indica Intermediate  786 45.20% 0.90% 26.46% 27.48% NA
Temperate Japonica  767 97.40% 0.00% 1.17% 1.43% NA
Tropical Japonica  504 74.00% 0.40% 19.64% 5.95% NA
Japonica Intermediate  241 88.40% 0.80% 8.71% 2.07% NA
VI/Aromatic  96 100.00% 0.00% 0.00% 0.00% NA
Intermediate  90 73.30% 4.40% 12.22% 10.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1125501745 A -> T LOC_Os11g42370.1 missense_variant ; p.Met41Leu; MODERATE nonsynonymous_codon ; M41L Average:69.763; most accessible tissue: Zhenshan97 panicle, score: 85.665 benign -0.508 TOLERATED 0.42
vg1125501745 A -> DEL LOC_Os11g42370.1 N frameshift_variant Average:69.763; most accessible tissue: Zhenshan97 panicle, score: 85.665 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1125501745 NA 2.02E-09 Heading_date Ind_All Not Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg1125501745 NA 2.77E-09 mr1063 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125501745 2.52E-20 4.41E-40 mr1133 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125501745 1.74E-19 1.41E-33 mr1133 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125501745 NA 2.09E-06 mr1533 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125501745 1.30E-06 5.04E-12 mr1540 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125501745 1.13E-07 1.13E-07 mr1540 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125501745 7.50E-13 6.81E-17 mr1662 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125501745 3.43E-07 2.19E-11 mr1662 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125501745 1.44E-11 9.07E-20 mr1667 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125501745 2.07E-11 9.49E-18 mr1667 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125501745 4.71E-06 NA mr1732 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125501745 4.34E-07 1.36E-07 mr1732 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125501745 NA 7.94E-06 mr1925 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125501745 NA 1.93E-06 mr1980 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125501745 NA 8.27E-07 mr1063_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125501745 3.40E-20 1.78E-39 mr1133_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125501745 1.56E-17 4.53E-32 mr1133_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125501745 8.73E-11 1.24E-13 mr1662_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125501745 7.79E-06 1.23E-09 mr1662_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125501745 9.46E-13 2.66E-22 mr1667_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125501745 6.42E-13 2.17E-20 mr1667_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251