\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1125471656:

Variant ID: vg1125471656 (JBrowse)Variation Type: SNP
Chromosome: chr11Position: 25471656
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 1.00, T: 0.01, others allele: 0.00, population size: 117. )

Flanking Sequence (100 bp) in Reference Genome:


TTCAAATCCATTCAAAATCAGTCAAAATTTTAAAAAATTTCGTACGAAAAAAATTCCGAAATTTCGGTTCTATCGCTCCCCCTCGGCAGAAACCTAATTT[C/T]
GAAATTTGAAACCCTGGCCGGAGCGCGCCGAACGCGCCGCAAGAGCACGCTGTGGTGGTGGCGGCCTCCACGGCGGAGGAGGAGGTCGTCGGGGAGTTCG

Reverse complement sequence

CGAACTCCCCGACGACCTCCTCCTCCGCCGTGGAGGCCGCCACCACCACAGCGTGCTCTTGCGGCGCGTTCGGCGCGCTCCGGCCAGGGTTTCAAATTTC[G/A]
AAATTAGGTTTCTGCCGAGGGGGAGCGATAGAACCGAAATTTCGGAATTTTTTTCGTACGAAATTTTTTAAAATTTTGACTGATTTTGAATGGATTTGAA

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 80.00% 19.60% 0.06% 0.32% NA
All Indica  2759 73.10% 26.70% 0.11% 0.04% NA
All Japonica  1512 91.10% 8.90% 0.00% 0.00% NA
Aus  269 80.70% 14.50% 0.00% 4.83% NA
Indica I  595 95.50% 4.40% 0.17% 0.00% NA
Indica II  465 95.50% 4.30% 0.00% 0.22% NA
Indica III  913 44.50% 55.50% 0.00% 0.00% NA
Indica Intermediate  786 76.30% 23.40% 0.25% 0.00% NA
Temperate Japonica  767 99.00% 1.00% 0.00% 0.00% NA
Tropical Japonica  504 80.00% 20.00% 0.00% 0.00% NA
Japonica Intermediate  241 89.60% 10.40% 0.00% 0.00% NA
VI/Aromatic  96 100.00% 0.00% 0.00% 0.00% NA
Intermediate  90 80.00% 18.90% 0.00% 1.11% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1125471656 C -> T LOC_Os11g42290.1 upstream_gene_variant ; 3525.0bp to feature; MODIFIER silent_mutation Average:49.912; most accessible tissue: Minghui63 root, score: 84.447 N N N N
vg1125471656 C -> T LOC_Os11g42300.1 downstream_gene_variant ; 2494.0bp to feature; MODIFIER silent_mutation Average:49.912; most accessible tissue: Minghui63 root, score: 84.447 N N N N
vg1125471656 C -> T LOC_Os11g42290-LOC_Os11g42300 intergenic_region ; MODIFIER silent_mutation Average:49.912; most accessible tissue: Minghui63 root, score: 84.447 N N N N
vg1125471656 C -> DEL N N silent_mutation Average:49.912; most accessible tissue: Minghui63 root, score: 84.447 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1125471656 NA 1.43E-07 mr1213 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125471656 1.78E-15 1.91E-16 mr1662 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125471656 2.16E-08 2.82E-08 mr1662 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125471656 NA 5.41E-06 mr1662 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125471656 1.27E-14 1.22E-17 mr1662_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125471656 6.96E-07 2.45E-08 mr1662_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125471656 8.61E-06 2.27E-06 mr1662_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251