\
| Variant ID: vg1125471656 (JBrowse) | Variation Type: SNP |
| Chromosome: chr11 | Position: 25471656 |
| Reference Allele: C | Alternative Allele: T |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 1.00, T: 0.01, others allele: 0.00, population size: 117. )
TTCAAATCCATTCAAAATCAGTCAAAATTTTAAAAAATTTCGTACGAAAAAAATTCCGAAATTTCGGTTCTATCGCTCCCCCTCGGCAGAAACCTAATTT[C/T]
GAAATTTGAAACCCTGGCCGGAGCGCGCCGAACGCGCCGCAAGAGCACGCTGTGGTGGTGGCGGCCTCCACGGCGGAGGAGGAGGTCGTCGGGGAGTTCG
CGAACTCCCCGACGACCTCCTCCTCCGCCGTGGAGGCCGCCACCACCACAGCGTGCTCTTGCGGCGCGTTCGGCGCGCTCCGGCCAGGGTTTCAAATTTC[G/A]
AAATTAGGTTTCTGCCGAGGGGGAGCGATAGAACCGAAATTTCGGAATTTTTTTCGTACGAAATTTTTTAAAATTTTGACTGATTTTGAATGGATTTGAA
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 80.00% | 19.60% | 0.06% | 0.32% | NA |
| All Indica | 2759 | 73.10% | 26.70% | 0.11% | 0.04% | NA |
| All Japonica | 1512 | 91.10% | 8.90% | 0.00% | 0.00% | NA |
| Aus | 269 | 80.70% | 14.50% | 0.00% | 4.83% | NA |
| Indica I | 595 | 95.50% | 4.40% | 0.17% | 0.00% | NA |
| Indica II | 465 | 95.50% | 4.30% | 0.00% | 0.22% | NA |
| Indica III | 913 | 44.50% | 55.50% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 76.30% | 23.40% | 0.25% | 0.00% | NA |
| Temperate Japonica | 767 | 99.00% | 1.00% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 80.00% | 20.00% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 89.60% | 10.40% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 80.00% | 18.90% | 0.00% | 1.11% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1125471656 | C -> T | LOC_Os11g42290.1 | upstream_gene_variant ; 3525.0bp to feature; MODIFIER | silent_mutation | Average:49.912; most accessible tissue: Minghui63 root, score: 84.447 | N | N | N | N |
| vg1125471656 | C -> T | LOC_Os11g42300.1 | downstream_gene_variant ; 2494.0bp to feature; MODIFIER | silent_mutation | Average:49.912; most accessible tissue: Minghui63 root, score: 84.447 | N | N | N | N |
| vg1125471656 | C -> T | LOC_Os11g42290-LOC_Os11g42300 | intergenic_region ; MODIFIER | silent_mutation | Average:49.912; most accessible tissue: Minghui63 root, score: 84.447 | N | N | N | N |
| vg1125471656 | C -> DEL | N | N | silent_mutation | Average:49.912; most accessible tissue: Minghui63 root, score: 84.447 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1125471656 | NA | 1.43E-07 | mr1213 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1125471656 | 1.78E-15 | 1.91E-16 | mr1662 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1125471656 | 2.16E-08 | 2.82E-08 | mr1662 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1125471656 | NA | 5.41E-06 | mr1662 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1125471656 | 1.27E-14 | 1.22E-17 | mr1662_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1125471656 | 6.96E-07 | 2.45E-08 | mr1662_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1125471656 | 8.61E-06 | 2.27E-06 | mr1662_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |