Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1125470232:

Variant ID: vg1125470232 (JBrowse)	Variation Type: SNP
Chromosome: chr11	Position: 25470232
Reference Allele: A	Alternative Allele: G
Primary Allele: A	Secondary Allele: G

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.64, G: 0.36, others allele: 0.00, population size: 107. )

Flanking Sequence (100 bp) in Reference Genome:

CGCACGCGGGCATCTGCTAATTATTAGCACGTGGCGTGGCGTTTCAGTTATACCCTATTACTATGCATGTGTTAATGTGAATGCACGTATGGCAAGACTA[A/G]
CTAACGGCTAACGGAAGAATTTTGTTACTTTTCATTCCGAGTACGTCTCCAAATTAAGACCAACCTAGCTAGAATATCTTAGACTTATACTACCTCCGGT

Reverse complement sequence

ACCGGAGGTAGTATAAGTCTAAGATATTCTAGCTAGGTTGGTCTTAATTTGGAGACGTACTCGGAATGAAAAGTAACAAAATTCTTCCGTTAGCCGTTAG[T/C]
TAGTCTTGCCATACGTGCATTCACATTAACACATGCATAGTAATAGGGTATAACTGAAACGCCACGCCACGTGCTAATAATTAGCAGATGCCCGCGTGCG

Allele Frequencies:

Populations	Population Size	Frequency of A(primary allele)	Frequency of G(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	42.40%	22.10%	0.72%	34.81%	NA
All Indica	2759	27.20%	20.70%	0.98%	51.14%	NA
All Japonica	1512	66.50%	21.80%	0.33%	11.44%	NA
Aus	269	59.50%	26.80%	0.37%	13.38%	NA
Indica I	595	45.20%	42.20%	0.67%	11.93%	NA
Indica II	465	42.80%	35.10%	0.65%	21.51%	NA
Indica III	913	7.20%	3.60%	0.88%	88.28%	NA
Indica Intermediate	786	27.60%	15.60%	1.53%	55.22%	NA
Temperate Japonica	767	92.30%	5.10%	0.00%	2.61%	NA
Tropical Japonica	504	23.80%	50.20%	0.99%	25.00%	NA
Japonica Intermediate	241	73.40%	15.40%	0.00%	11.20%	NA
VI/Aromatic	96	46.90%	53.10%	0.00%	0.00%	NA
Intermediate	90	45.60%	25.60%	1.11%	27.78%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1125470232	A -> DEL	N	N	silent_mutation	Average:49.312; most accessible tissue: Callus, score: 87.68	N	N	N	N
vg1125470232	A -> G	LOC_Os11g42280.1	upstream_gene_variant ; 4566.0bp to feature; MODIFIER	silent_mutation	Average:49.312; most accessible tissue: Callus, score: 87.68	N	N	N	N
vg1125470232	A -> G	LOC_Os11g42290.1	upstream_gene_variant ; 2101.0bp to feature; MODIFIER	silent_mutation	Average:49.312; most accessible tissue: Callus, score: 87.68	N	N	N	N
vg1125470232	A -> G	LOC_Os11g42300.1	downstream_gene_variant ; 3918.0bp to feature; MODIFIER	silent_mutation	Average:49.312; most accessible tissue: Callus, score: 87.68	N	N	N	N
vg1125470232	A -> G	LOC_Os11g42290-LOC_Os11g42300	intergenic_region ; MODIFIER	silent_mutation	Average:49.312; most accessible tissue: Callus, score: 87.68	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1125470232	1.78E-14	1.35E-19	mr1191	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125470232	1.82E-09	1.19E-11	mr1191	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125470232	NA	7.04E-06	mr1530	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125470232	5.56E-13	1.95E-21	mr1644	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125470232	1.32E-07	2.60E-10	mr1644	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125470232	6.63E-25	1.58E-33	mr1662	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125470232	4.63E-16	7.17E-21	mr1662	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125470232	6.31E-07	1.47E-08	mr1662	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125470232	NA	3.15E-07	mr1723	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125470232	NA	2.11E-07	mr1745	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125470232	NA	3.59E-07	mr1133_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125470232	1.27E-17	1.17E-29	mr1191_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125470232	3.29E-11	1.58E-18	mr1191_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125470232	NA	4.02E-08	mr1530_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125470232	3.14E-26	1.87E-42	mr1662_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125470232	3.68E-17	5.66E-25	mr1662_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125470232	9.03E-07	7.26E-09	mr1662_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125470232	NA	2.61E-08	mr1745_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251