\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1125470232:

Variant ID: vg1125470232 (JBrowse)Variation Type: SNP
Chromosome: chr11Position: 25470232
Reference Allele: AAlternative Allele: G
Primary Allele: ASecondary Allele: G

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.64, G: 0.36, others allele: 0.00, population size: 107. )

Flanking Sequence (100 bp) in Reference Genome:


CGCACGCGGGCATCTGCTAATTATTAGCACGTGGCGTGGCGTTTCAGTTATACCCTATTACTATGCATGTGTTAATGTGAATGCACGTATGGCAAGACTA[A/G]
CTAACGGCTAACGGAAGAATTTTGTTACTTTTCATTCCGAGTACGTCTCCAAATTAAGACCAACCTAGCTAGAATATCTTAGACTTATACTACCTCCGGT

Reverse complement sequence

ACCGGAGGTAGTATAAGTCTAAGATATTCTAGCTAGGTTGGTCTTAATTTGGAGACGTACTCGGAATGAAAAGTAACAAAATTCTTCCGTTAGCCGTTAG[T/C]
TAGTCTTGCCATACGTGCATTCACATTAACACATGCATAGTAATAGGGTATAACTGAAACGCCACGCCACGTGCTAATAATTAGCAGATGCCCGCGTGCG

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 42.40% 22.10% 0.72% 34.81% NA
All Indica  2759 27.20% 20.70% 0.98% 51.14% NA
All Japonica  1512 66.50% 21.80% 0.33% 11.44% NA
Aus  269 59.50% 26.80% 0.37% 13.38% NA
Indica I  595 45.20% 42.20% 0.67% 11.93% NA
Indica II  465 42.80% 35.10% 0.65% 21.51% NA
Indica III  913 7.20% 3.60% 0.88% 88.28% NA
Indica Intermediate  786 27.60% 15.60% 1.53% 55.22% NA
Temperate Japonica  767 92.30% 5.10% 0.00% 2.61% NA
Tropical Japonica  504 23.80% 50.20% 0.99% 25.00% NA
Japonica Intermediate  241 73.40% 15.40% 0.00% 11.20% NA
VI/Aromatic  96 46.90% 53.10% 0.00% 0.00% NA
Intermediate  90 45.60% 25.60% 1.11% 27.78% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1125470232 A -> DEL N N silent_mutation Average:49.312; most accessible tissue: Callus, score: 87.68 N N N N
vg1125470232 A -> G LOC_Os11g42280.1 upstream_gene_variant ; 4566.0bp to feature; MODIFIER silent_mutation Average:49.312; most accessible tissue: Callus, score: 87.68 N N N N
vg1125470232 A -> G LOC_Os11g42290.1 upstream_gene_variant ; 2101.0bp to feature; MODIFIER silent_mutation Average:49.312; most accessible tissue: Callus, score: 87.68 N N N N
vg1125470232 A -> G LOC_Os11g42300.1 downstream_gene_variant ; 3918.0bp to feature; MODIFIER silent_mutation Average:49.312; most accessible tissue: Callus, score: 87.68 N N N N
vg1125470232 A -> G LOC_Os11g42290-LOC_Os11g42300 intergenic_region ; MODIFIER silent_mutation Average:49.312; most accessible tissue: Callus, score: 87.68 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1125470232 1.78E-14 1.35E-19 mr1191 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125470232 1.82E-09 1.19E-11 mr1191 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125470232 NA 7.04E-06 mr1530 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125470232 5.56E-13 1.95E-21 mr1644 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125470232 1.32E-07 2.60E-10 mr1644 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125470232 6.63E-25 1.58E-33 mr1662 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125470232 4.63E-16 7.17E-21 mr1662 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125470232 6.31E-07 1.47E-08 mr1662 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125470232 NA 3.15E-07 mr1723 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125470232 NA 2.11E-07 mr1745 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125470232 NA 3.59E-07 mr1133_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125470232 1.27E-17 1.17E-29 mr1191_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125470232 3.29E-11 1.58E-18 mr1191_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125470232 NA 4.02E-08 mr1530_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125470232 3.14E-26 1.87E-42 mr1662_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125470232 3.68E-17 5.66E-25 mr1662_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125470232 9.03E-07 7.26E-09 mr1662_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125470232 NA 2.61E-08 mr1745_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251