Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923).

Detailed information for vg1125465977:

Variant ID: vg1125465977 (JBrowse)	Variation Type: SNP
Chromosome: chr11	Position: 25465977
Reference Allele: G	Alternative Allele: A
Primary Allele: G	Secondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

ATCGCTCATGCTCGCACTTCGCGGATCAGAATTAACACCAGCTGCTTTATTAAAGCGGAGCTAGCACCAAAACAAGAGTGGTGCACTATTTTTTTCGGAC[G/A]
CGCAAAAAGATTACATGTTAATATATTAGAAGAATAGAGGTTTTGTTACAACGCAATCGGCCAGACAGACCTATGCTGTGAGGGAGAAAACCACTCTAAC

Reverse complement sequence

GTTAGAGTGGTTTTCTCCCTCACAGCATAGGTCTGTCTGGCCGATTGCGTTGTAACAAAACCTCTATTCTTCTAATATATTAACATGTAATCTTTTTGCG[C/T]
GTCCGAAAAAAATAGTGCACCACTCTTGTTTTGGTGCTAGCTCCGCTTTAATAAAGCAGCTGGTGTTAATTCTGATCCGCGAAGTGCGAGCATGAGCGAT

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	74.60%	25.10%	0.36%	0.00%	NA
All Indica	2759	59.70%	40.20%	0.11%	0.00%	NA
All Japonica	1512	96.20%	3.70%	0.07%	0.00%	NA
Aus	269	95.20%	0.00%	4.83%	0.00%	NA
Indica I	595	51.60%	48.20%	0.17%	0.00%	NA
Indica II	465	62.80%	37.20%	0.00%	0.00%	NA
Indica III	913	63.70%	36.10%	0.11%	0.00%	NA
Indica Intermediate	786	59.30%	40.60%	0.13%	0.00%	NA
Temperate Japonica	767	97.70%	2.20%	0.13%	0.00%	NA
Tropical Japonica	504	93.10%	6.90%	0.00%	0.00%	NA
Japonica Intermediate	241	98.30%	1.70%	0.00%	0.00%	NA
VI/Aromatic	96	100.00%	0.00%	0.00%	0.00%	NA
Intermediate	90	77.80%	22.20%	0.00%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1125465977	G -> A	LOC_Os11g42270.1	upstream_gene_variant ; 2979.0bp to feature; MODIFIER	silent_mutation	Average:59.211; most accessible tissue: Callus, score: 86.592	N	N	N	N
vg1125465977	G -> A	LOC_Os11g42280.1	upstream_gene_variant ; 311.0bp to feature; MODIFIER	silent_mutation	Average:59.211; most accessible tissue: Callus, score: 86.592	N	N	N	N
vg1125465977	G -> A	LOC_Os11g42290.1	downstream_gene_variant ; 580.0bp to feature; MODIFIER	silent_mutation	Average:59.211; most accessible tissue: Callus, score: 86.592	N	N	N	N
vg1125465977	G -> A	LOC_Os11g42280-LOC_Os11g42290	intergenic_region ; MODIFIER	silent_mutation	Average:59.211; most accessible tissue: Callus, score: 86.592	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1125465977	6.49E-09	1.10E-16	mr1191	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125465977	1.09E-09	1.84E-12	mr1191	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125465977	3.17E-11	5.57E-19	mr1644	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125465977	1.48E-11	8.76E-16	mr1644	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125465977	NA	6.89E-06	mr1908	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125465977	1.81E-09	3.83E-24	mr1191_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125465977	4.06E-10	4.81E-17	mr1191_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125465977	NA	3.99E-06	mr1380_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125465977	NA	1.17E-06	mr1561_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125465977	NA	3.21E-07	mr1875_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125465977	NA	6.86E-07	mr1908_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251