Variant ID: vg1125465977 (JBrowse) | Variation Type: SNP |
Chromosome: chr11 | Position: 25465977 |
Reference Allele: G | Alternative Allele: A |
Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele: Not determined.
ATCGCTCATGCTCGCACTTCGCGGATCAGAATTAACACCAGCTGCTTTATTAAAGCGGAGCTAGCACCAAAACAAGAGTGGTGCACTATTTTTTTCGGAC[G/A]
CGCAAAAAGATTACATGTTAATATATTAGAAGAATAGAGGTTTTGTTACAACGCAATCGGCCAGACAGACCTATGCTGTGAGGGAGAAAACCACTCTAAC
GTTAGAGTGGTTTTCTCCCTCACAGCATAGGTCTGTCTGGCCGATTGCGTTGTAACAAAACCTCTATTCTTCTAATATATTAACATGTAATCTTTTTGCG[C/T]
GTCCGAAAAAAATAGTGCACCACTCTTGTTTTGGTGCTAGCTCCGCTTTAATAAAGCAGCTGGTGTTAATTCTGATCCGCGAAGTGCGAGCATGAGCGAT
Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
---|---|---|---|---|---|---|
All | 4726 | 74.60% | 25.10% | 0.36% | 0.00% | NA |
All Indica | 2759 | 59.70% | 40.20% | 0.11% | 0.00% | NA |
All Japonica | 1512 | 96.20% | 3.70% | 0.07% | 0.00% | NA |
Aus | 269 | 95.20% | 0.00% | 4.83% | 0.00% | NA |
Indica I | 595 | 51.60% | 48.20% | 0.17% | 0.00% | NA |
Indica II | 465 | 62.80% | 37.20% | 0.00% | 0.00% | NA |
Indica III | 913 | 63.70% | 36.10% | 0.11% | 0.00% | NA |
Indica Intermediate | 786 | 59.30% | 40.60% | 0.13% | 0.00% | NA |
Temperate Japonica | 767 | 97.70% | 2.20% | 0.13% | 0.00% | NA |
Tropical Japonica | 504 | 93.10% | 6.90% | 0.00% | 0.00% | NA |
Japonica Intermediate | 241 | 98.30% | 1.70% | 0.00% | 0.00% | NA |
VI/Aromatic | 96 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
Intermediate | 90 | 77.80% | 22.20% | 0.00% | 0.00% | NA |
Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
---|---|---|---|---|---|---|---|---|---|
vg1125465977 | G -> A | LOC_Os11g42270.1 | upstream_gene_variant ; 2979.0bp to feature; MODIFIER | silent_mutation | Average:59.211; most accessible tissue: Callus, score: 86.592 | N | N | N | N |
vg1125465977 | G -> A | LOC_Os11g42280.1 | upstream_gene_variant ; 311.0bp to feature; MODIFIER | silent_mutation | Average:59.211; most accessible tissue: Callus, score: 86.592 | N | N | N | N |
vg1125465977 | G -> A | LOC_Os11g42290.1 | downstream_gene_variant ; 580.0bp to feature; MODIFIER | silent_mutation | Average:59.211; most accessible tissue: Callus, score: 86.592 | N | N | N | N |
vg1125465977 | G -> A | LOC_Os11g42280-LOC_Os11g42290 | intergenic_region ; MODIFIER | silent_mutation | Average:59.211; most accessible tissue: Callus, score: 86.592 | N | N | N | N |
Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
---|---|---|---|---|---|---|
vg1125465977 | 6.49E-09 | 1.10E-16 | mr1191 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg1125465977 | 1.09E-09 | 1.84E-12 | mr1191 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg1125465977 | 3.17E-11 | 5.57E-19 | mr1644 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg1125465977 | 1.48E-11 | 8.76E-16 | mr1644 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg1125465977 | NA | 6.89E-06 | mr1908 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg1125465977 | 1.81E-09 | 3.83E-24 | mr1191_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg1125465977 | 4.06E-10 | 4.81E-17 | mr1191_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg1125465977 | NA | 3.99E-06 | mr1380_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg1125465977 | NA | 1.17E-06 | mr1561_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg1125465977 | NA | 3.21E-07 | mr1875_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg1125465977 | NA | 6.86E-07 | mr1908_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |