\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1125465977:

Variant ID: vg1125465977 (JBrowse)Variation Type: SNP
Chromosome: chr11Position: 25465977
Reference Allele: GAlternative Allele: A
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


ATCGCTCATGCTCGCACTTCGCGGATCAGAATTAACACCAGCTGCTTTATTAAAGCGGAGCTAGCACCAAAACAAGAGTGGTGCACTATTTTTTTCGGAC[G/A]
CGCAAAAAGATTACATGTTAATATATTAGAAGAATAGAGGTTTTGTTACAACGCAATCGGCCAGACAGACCTATGCTGTGAGGGAGAAAACCACTCTAAC

Reverse complement sequence

GTTAGAGTGGTTTTCTCCCTCACAGCATAGGTCTGTCTGGCCGATTGCGTTGTAACAAAACCTCTATTCTTCTAATATATTAACATGTAATCTTTTTGCG[C/T]
GTCCGAAAAAAATAGTGCACCACTCTTGTTTTGGTGCTAGCTCCGCTTTAATAAAGCAGCTGGTGTTAATTCTGATCCGCGAAGTGCGAGCATGAGCGAT

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 74.60% 25.10% 0.36% 0.00% NA
All Indica  2759 59.70% 40.20% 0.11% 0.00% NA
All Japonica  1512 96.20% 3.70% 0.07% 0.00% NA
Aus  269 95.20% 0.00% 4.83% 0.00% NA
Indica I  595 51.60% 48.20% 0.17% 0.00% NA
Indica II  465 62.80% 37.20% 0.00% 0.00% NA
Indica III  913 63.70% 36.10% 0.11% 0.00% NA
Indica Intermediate  786 59.30% 40.60% 0.13% 0.00% NA
Temperate Japonica  767 97.70% 2.20% 0.13% 0.00% NA
Tropical Japonica  504 93.10% 6.90% 0.00% 0.00% NA
Japonica Intermediate  241 98.30% 1.70% 0.00% 0.00% NA
VI/Aromatic  96 100.00% 0.00% 0.00% 0.00% NA
Intermediate  90 77.80% 22.20% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1125465977 G -> A LOC_Os11g42270.1 upstream_gene_variant ; 2979.0bp to feature; MODIFIER silent_mutation Average:59.211; most accessible tissue: Callus, score: 86.592 N N N N
vg1125465977 G -> A LOC_Os11g42280.1 upstream_gene_variant ; 311.0bp to feature; MODIFIER silent_mutation Average:59.211; most accessible tissue: Callus, score: 86.592 N N N N
vg1125465977 G -> A LOC_Os11g42290.1 downstream_gene_variant ; 580.0bp to feature; MODIFIER silent_mutation Average:59.211; most accessible tissue: Callus, score: 86.592 N N N N
vg1125465977 G -> A LOC_Os11g42280-LOC_Os11g42290 intergenic_region ; MODIFIER silent_mutation Average:59.211; most accessible tissue: Callus, score: 86.592 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1125465977 6.49E-09 1.10E-16 mr1191 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125465977 1.09E-09 1.84E-12 mr1191 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125465977 3.17E-11 5.57E-19 mr1644 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125465977 1.48E-11 8.76E-16 mr1644 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125465977 NA 6.89E-06 mr1908 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125465977 1.81E-09 3.83E-24 mr1191_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125465977 4.06E-10 4.81E-17 mr1191_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125465977 NA 3.99E-06 mr1380_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125465977 NA 1.17E-06 mr1561_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125465977 NA 3.21E-07 mr1875_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125465977 NA 6.86E-07 mr1908_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251