Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923).

Detailed information for vg1125434571:

Variant ID: vg1125434571 (JBrowse)	Variation Type: SNP
Chromosome: chr11	Position: 25434571
Reference Allele: T	Alternative Allele: G
Primary Allele: G	Secondary Allele: T

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.59, T: 0.41, others allele: 0.00, population size: 115. )

Flanking Sequence (100 bp) in Reference Genome:

TCCACCGCCGCCGGAGTTCAAGAGATGTGATGCCTCTTGAAACAACTTATCCTAACAACTATGGCAAGGACCTTCCTCCTCTTTGCCAGTATTCACTAGA[T/G]
AATGGCATTGCCTTTGGGGCATTTTATTCTTGTATTGCATTAGTTAAGACGTACATGTTAAATTCCAGCGTGCACAAGCCGGTCCAGGCCATGTGGTCAT

Reverse complement sequence

ATGACCACATGGCCTGGACCGGCTTGTGCACGCTGGAATTTAACATGTACGTCTTAACTAATGCAATACAAGAATAAAATGCCCCAAAGGCAATGCCATT[A/C]
TCTAGTGAATACTGGCAAAGAGGAGGAAGGTCCTTGCCATAGTTGTTAGGATAAGTTGTTTCAAGAGGCATCACATCTCTTGAACTCCGGCGGCGGTGGA

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	71.40%	28.60%	0.06%	0.00%	NA
All Indica	2759	76.70%	23.20%	0.07%	0.00%	NA
All Japonica	1512	66.90%	33.10%	0.00%	0.00%	NA
Aus	269	48.00%	52.00%	0.00%	0.00%	NA
Indica I	595	62.00%	37.60%	0.34%	0.00%	NA
Indica II	465	59.80%	40.20%	0.00%	0.00%	NA
Indica III	913	95.50%	4.50%	0.00%	0.00%	NA
Indica Intermediate	786	76.10%	23.90%	0.00%	0.00%	NA
Temperate Japonica	767	48.40%	51.60%	0.00%	0.00%	NA
Tropical Japonica	504	91.70%	8.30%	0.00%	0.00%	NA
Japonica Intermediate	241	74.30%	25.70%	0.00%	0.00%	NA
VI/Aromatic	96	49.00%	51.00%	0.00%	0.00%	NA
Intermediate	90	75.60%	23.30%	1.11%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1125434571	T -> G	LOC_Os11g42220.1	3_prime_UTR_variant ; 61.0bp to feature; MODIFIER	silent_mutation	Average:53.361; most accessible tissue: Callus, score: 81.992	N	N	N	N
vg1125434571	T -> G	LOC_Os11g42230.1	downstream_gene_variant ; 535.0bp to feature; MODIFIER	silent_mutation	Average:53.361; most accessible tissue: Callus, score: 81.992	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1125434571	9.96E-06	1.37E-08	mr1133	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125434571	3.14E-12	2.07E-15	mr1191	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125434571	2.68E-11	2.95E-14	mr1191	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125434571	6.97E-14	8.15E-20	mr1644	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125434571	3.04E-12	7.99E-17	mr1644	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125434571	NA	8.16E-07	mr1667	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125434571	NA	2.79E-07	mr1133_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125434571	6.32E-11	1.27E-18	mr1191_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125434571	2.16E-11	9.03E-18	mr1191_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125434571	8.09E-06	NA	mr1530_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251