\
| Variant ID: vg1125434571 (JBrowse) | Variation Type: SNP |
| Chromosome: chr11 | Position: 25434571 |
| Reference Allele: T | Alternative Allele: G |
| Primary Allele: G | Secondary Allele: T |
Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.59, T: 0.41, others allele: 0.00, population size: 115. )
TCCACCGCCGCCGGAGTTCAAGAGATGTGATGCCTCTTGAAACAACTTATCCTAACAACTATGGCAAGGACCTTCCTCCTCTTTGCCAGTATTCACTAGA[T/G]
AATGGCATTGCCTTTGGGGCATTTTATTCTTGTATTGCATTAGTTAAGACGTACATGTTAAATTCCAGCGTGCACAAGCCGGTCCAGGCCATGTGGTCAT
ATGACCACATGGCCTGGACCGGCTTGTGCACGCTGGAATTTAACATGTACGTCTTAACTAATGCAATACAAGAATAAAATGCCCCAAAGGCAATGCCATT[A/C]
TCTAGTGAATACTGGCAAAGAGGAGGAAGGTCCTTGCCATAGTTGTTAGGATAAGTTGTTTCAAGAGGCATCACATCTCTTGAACTCCGGCGGCGGTGGA
| Populations | Population Size | Frequency of G(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 71.40% | 28.60% | 0.06% | 0.00% | NA |
| All Indica | 2759 | 76.70% | 23.20% | 0.07% | 0.00% | NA |
| All Japonica | 1512 | 66.90% | 33.10% | 0.00% | 0.00% | NA |
| Aus | 269 | 48.00% | 52.00% | 0.00% | 0.00% | NA |
| Indica I | 595 | 62.00% | 37.60% | 0.34% | 0.00% | NA |
| Indica II | 465 | 59.80% | 40.20% | 0.00% | 0.00% | NA |
| Indica III | 913 | 95.50% | 4.50% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 76.10% | 23.90% | 0.00% | 0.00% | NA |
| Temperate Japonica | 767 | 48.40% | 51.60% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 91.70% | 8.30% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 74.30% | 25.70% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 49.00% | 51.00% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 75.60% | 23.30% | 1.11% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1125434571 | T -> G | LOC_Os11g42220.1 | 3_prime_UTR_variant ; 61.0bp to feature; MODIFIER | silent_mutation | Average:53.361; most accessible tissue: Callus, score: 81.992 | N | N | N | N |
| vg1125434571 | T -> G | LOC_Os11g42230.1 | downstream_gene_variant ; 535.0bp to feature; MODIFIER | silent_mutation | Average:53.361; most accessible tissue: Callus, score: 81.992 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1125434571 | 9.96E-06 | 1.37E-08 | mr1133 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1125434571 | 3.14E-12 | 2.07E-15 | mr1191 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1125434571 | 2.68E-11 | 2.95E-14 | mr1191 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1125434571 | 6.97E-14 | 8.15E-20 | mr1644 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1125434571 | 3.04E-12 | 7.99E-17 | mr1644 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1125434571 | NA | 8.16E-07 | mr1667 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1125434571 | NA | 2.79E-07 | mr1133_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1125434571 | 6.32E-11 | 1.27E-18 | mr1191_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1125434571 | 2.16E-11 | 9.03E-18 | mr1191_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1125434571 | 8.09E-06 | NA | mr1530_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |