\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1125429805:

Variant ID: vg1125429805 (JBrowse)Variation Type: SNP
Chromosome: chr11Position: 25429805
Reference Allele: GAlternative Allele: A
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.97, A: 0.03, others allele: 0.00, population size: 119. )

Flanking Sequence (100 bp) in Reference Genome:


AAGCGCTATAACGGGCTGCTATAGCGGTAACGAAGTGCTATATCGGGCGCTAAGTTACAACATGCTATCTTCAGTCCGCTACCGCTATTGCGGGCGCTAC[G/A]
AACGCTATTTATTACCTTGATAACAGTGTTGCTAACGCCATCCGATGATAGGGGCGTACCCCATATCATTTTTTTAAAAAGAAAATTTATATATAGTACT

Reverse complement sequence

AGTACTATATATAAATTTTCTTTTTAAAAAAATGATATGGGGTACGCCCCTATCATCGGATGGCGTTAGCAACACTGTTATCAAGGTAATAAATAGCGTT[C/T]
GTAGCGCCCGCAATAGCGGTAGCGGACTGAAGATAGCATGTTGTAACTTAGCGCCCGATATAGCACTTCGTTACCGCTATAGCAGCCCGTTATAGCGCTT

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 85.00% 14.70% 0.21% 0.00% NA
All Indica  2759 84.80% 14.90% 0.29% 0.00% NA
All Japonica  1512 83.30% 16.50% 0.13% 0.00% NA
Aus  269 94.80% 5.20% 0.00% 0.00% NA
Indica I  595 54.50% 44.50% 1.01% 0.00% NA
Indica II  465 79.60% 20.20% 0.22% 0.00% NA
Indica III  913 100.00% 0.00% 0.00% 0.00% NA
Indica Intermediate  786 93.10% 6.70% 0.13% 0.00% NA
Temperate Japonica  767 71.80% 27.90% 0.26% 0.00% NA
Tropical Japonica  504 98.80% 1.20% 0.00% 0.00% NA
Japonica Intermediate  241 87.60% 12.40% 0.00% 0.00% NA
VI/Aromatic  96 100.00% 0.00% 0.00% 0.00% NA
Intermediate  90 76.70% 23.30% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1125429805 G -> A LOC_Os11g42210.1 upstream_gene_variant ; 492.0bp to feature; MODIFIER silent_mutation Average:41.536; most accessible tissue: Zhenshan97 panicle, score: 57.341 N N N N
vg1125429805 G -> A LOC_Os11g42220.1 upstream_gene_variant ; 2618.0bp to feature; MODIFIER silent_mutation Average:41.536; most accessible tissue: Zhenshan97 panicle, score: 57.341 N N N N
vg1125429805 G -> A LOC_Os11g42200.1 downstream_gene_variant ; 3591.0bp to feature; MODIFIER silent_mutation Average:41.536; most accessible tissue: Zhenshan97 panicle, score: 57.341 N N N N
vg1125429805 G -> A LOC_Os11g42210-LOC_Os11g42220 intergenic_region ; MODIFIER silent_mutation Average:41.536; most accessible tissue: Zhenshan97 panicle, score: 57.341 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1125429805 8.85E-06 9.44E-11 mr1191 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125429805 7.46E-12 4.69E-14 mr1191 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125429805 2.05E-06 NA mr1484 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125429805 4.06E-10 6.50E-16 mr1530 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125429805 4.05E-06 1.03E-08 mr1530 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125429805 NA 7.76E-08 mr1530 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125429805 NA 3.87E-10 mr1644 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125429805 6.88E-11 2.63E-14 mr1644 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125429805 NA 3.50E-07 mr1662 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125429805 5.16E-08 5.49E-14 mr1662 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125429805 1.12E-10 NA mr1745 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125429805 2.53E-06 1.19E-10 mr1745 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125429805 3.55E-06 NA mr1745 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125429805 8.92E-06 9.80E-17 mr1191_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125429805 9.38E-13 8.58E-22 mr1191_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125429805 2.64E-13 2.71E-24 mr1530_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125429805 1.70E-06 3.28E-12 mr1530_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125429805 2.98E-08 2.63E-13 mr1530_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125429805 NA 7.08E-08 mr1662_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125429805 5.31E-09 1.82E-16 mr1662_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125429805 5.24E-08 NA mr1745_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125429805 2.05E-06 3.42E-15 mr1745_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251