\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1125418465:

Variant ID: vg1125418465 (JBrowse)Variation Type: SNP
Chromosome: chr11Position: 25418465
Reference Allele: CAlternative Allele: T,A
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.95, T: 0.05, others allele: 0.00, population size: 204. )

Flanking Sequence (100 bp) in Reference Genome:


TTTGAATTATTCAACATTAACATGGACAGGTTAATATAGGATCGAATCATAAGAACTAAGCCAACCAGAGAGGGGTGAATGGTTGATATACCCCAAAACC[C/T,A]
AAACTTTTAGCGGAAATAAAAGTTACTCTCAAATTCGATGTAGATCAGTCTGACCGAGGTTGATCCGCCGGTCTGACCGAGCTCGTGCCGCCGGTCTGAC

Reverse complement sequence

GTCAGACCGGCGGCACGAGCTCGGTCAGACCGGCGGATCAACCTCGGTCAGACTGATCTACATCGAATTTGAGAGTAACTTTTATTTCCGCTAAAAGTTT[G/A,T]
GGTTTTGGGGTATATCAACCATTCACCCCTCTCTGGTTGGCTTAGTTCTTATGATTCGATCCTATATTAACCTGTCCATGTTAATGTTGAATAATTCAAA

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 81.90% 18.10% 0.02% 0.00% NA
All Indica  2759 92.90% 7.10% 0.04% 0.00% NA
All Japonica  1512 65.30% 34.70% 0.00% 0.00% NA
Aus  269 72.10% 27.90% 0.00% 0.00% NA
Indica I  595 98.30% 1.70% 0.00% 0.00% NA
Indica II  465 84.10% 15.90% 0.00% 0.00% NA
Indica III  913 95.80% 4.10% 0.11% 0.00% NA
Indica Intermediate  786 90.60% 9.40% 0.00% 0.00% NA
Temperate Japonica  767 84.00% 16.00% 0.00% 0.00% NA
Tropical Japonica  504 41.70% 58.30% 0.00% 0.00% NA
Japonica Intermediate  241 55.20% 44.80% 0.00% 0.00% NA
VI/Aromatic  96 51.00% 49.00% 0.00% 0.00% NA
Intermediate  90 84.40% 15.60% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1125418465 C -> T LOC_Os11g42190.1 upstream_gene_variant ; 2131.0bp to feature; MODIFIER silent_mutation Average:53.103; most accessible tissue: Zhenshan97 panicle, score: 67.02 N N N N
vg1125418465 C -> T LOC_Os11g42190-LOC_Os11g42200 intergenic_region ; MODIFIER silent_mutation Average:53.103; most accessible tissue: Zhenshan97 panicle, score: 67.02 N N N N
vg1125418465 C -> A LOC_Os11g42190.1 upstream_gene_variant ; 2131.0bp to feature; MODIFIER N Average:53.103; most accessible tissue: Zhenshan97 panicle, score: 67.02 N N N N
vg1125418465 C -> A LOC_Os11g42190-LOC_Os11g42200 intergenic_region ; MODIFIER N Average:53.103; most accessible tissue: Zhenshan97 panicle, score: 67.02 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1125418465 NA 5.96E-06 mr1063 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125418465 NA 2.75E-12 mr1205 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125418465 3.72E-11 9.96E-12 mr1238 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125418465 2.39E-08 5.16E-09 mr1309 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125418465 NA 8.27E-06 mr1328 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125418465 9.88E-08 6.92E-07 mr1662 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125418465 1.86E-06 1.35E-06 mr1841 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125418465 7.74E-10 2.49E-10 mr1238_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125418465 1.71E-09 2.92E-10 mr1484_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125418465 1.27E-11 1.98E-09 mr1662_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125418465 1.37E-06 NA mr1662_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125418465 5.55E-12 6.66E-12 mr1841_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125418465 2.07E-06 9.48E-07 mr1900_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125418465 3.26E-07 3.26E-07 mr1945_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251