\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1125418435:

Variant ID: vg1125418435 (JBrowse)Variation Type: SNP
Chromosome: chr11Position: 25418435
Reference Allele: AAlternative Allele: G
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.77, A: 0.23, others allele: 0.00, population size: 204. )

Flanking Sequence (100 bp) in Reference Genome:


ATTTGTCATTTGATATTGTTCCAGCTGGGTTTTGAATTATTCAACATTAACATGGACAGGTTAATATAGGATCGAATCATAAGAACTAAGCCAACCAGAG[A/G]
GGGGTGAATGGTTGATATACCCCAAAACCCAAACTTTTAGCGGAAATAAAAGTTACTCTCAAATTCGATGTAGATCAGTCTGACCGAGGTTGATCCGCCG

Reverse complement sequence

CGGCGGATCAACCTCGGTCAGACTGATCTACATCGAATTTGAGAGTAACTTTTATTTCCGCTAAAAGTTTGGGTTTTGGGGTATATCAACCATTCACCCC[T/C]
CTCTGGTTGGCTTAGTTCTTATGATTCGATCCTATATTAACCTGTCCATGTTAATGTTGAATAATTCAAAACCCAGCTGGAACAATATCAAATGACAAAT

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 53.60% 46.30% 0.13% 0.00% NA
All Indica  2759 47.80% 52.10% 0.14% 0.00% NA
All Japonica  1512 63.30% 36.70% 0.00% 0.00% NA
Aus  269 56.10% 43.90% 0.00% 0.00% NA
Indica I  595 54.30% 45.50% 0.17% 0.00% NA
Indica II  465 40.60% 58.90% 0.43% 0.00% NA
Indica III  913 52.90% 47.00% 0.11% 0.00% NA
Indica Intermediate  786 41.10% 58.90% 0.00% 0.00% NA
Temperate Japonica  767 46.50% 53.50% 0.00% 0.00% NA
Tropical Japonica  504 83.70% 16.30% 0.00% 0.00% NA
Japonica Intermediate  241 73.90% 26.10% 0.00% 0.00% NA
VI/Aromatic  96 49.00% 51.00% 0.00% 0.00% NA
Intermediate  90 64.40% 33.30% 2.22% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1125418435 A -> G LOC_Os11g42190.1 upstream_gene_variant ; 2101.0bp to feature; MODIFIER silent_mutation Average:50.615; most accessible tissue: Zhenshan97 root, score: 61.518 N N N N
vg1125418435 A -> G LOC_Os11g42190-LOC_Os11g42200 intergenic_region ; MODIFIER silent_mutation Average:50.615; most accessible tissue: Zhenshan97 root, score: 61.518 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1125418435 8.90E-10 NA mr1191 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125418435 7.15E-09 2.81E-11 mr1191 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125418435 NA 4.94E-06 mr1543 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125418435 1.09E-09 4.18E-11 mr1644 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125418435 1.42E-07 9.02E-11 mr1644 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125418435 2.65E-06 8.20E-10 mr1662 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125418435 2.32E-06 NA mr1745 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125418435 2.61E-09 NA mr1191_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125418435 3.18E-10 7.74E-16 mr1191_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125418435 2.41E-08 NA mr1530_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125418435 NA 6.89E-07 mr1530_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125418435 NA 1.46E-07 mr1662_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125418435 2.17E-07 9.22E-12 mr1662_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125418435 5.01E-06 NA mr1745_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125418435 NA 1.25E-07 mr1745_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251