Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923).

Detailed information for vg1125401366:

Variant ID: vg1125401366 (JBrowse)	Variation Type: SNP
Chromosome: chr11	Position: 25401366
Reference Allele: G	Alternative Allele: T
Primary Allele: G	Secondary Allele: T

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.98, T: 0.01, others allele: 0.00, population size: 122. )

Flanking Sequence (100 bp) in Reference Genome:

CCATGCATGGACAAAAGATTTGTTTGTAAAAAAAATAAATTGTACAGAGAGAACATGTTTTCTTATAAAGGAAAAAAATATTTTGAAATTTTAAATTAAA[G/T]
TTTCAAAAATAAAATAAATAATCCAAGGTTCACCTTTCTGATTGAGCGACCACCGGCAATACGACTGTTTTTGCCAAATTTGCATAAATGCTTATCAAAT

Reverse complement sequence

ATTTGATAAGCATTTATGCAAATTTGGCAAAAACAGTCGTATTGCCGGTGGTCGCTCAATCAGAAAGGTGAACCTTGGATTATTTATTTTATTTTTGAAA[C/A]
TTTAATTTAAAATTTCAAAATATTTTTTTCCTTTATAAGAAAACATGTTCTCTCTGTACAATTTATTTTTTTTACAAACAAATCTTTTGTCCATGCATGG

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	77.20%	22.70%	0.06%	0.00%	NA
All Indica	2759	63.20%	36.70%	0.11%	0.00%	NA
All Japonica	1512	96.70%	3.30%	0.00%	0.00%	NA
Aus	269	100.00%	0.00%	0.00%	0.00%	NA
Indica I	595	65.70%	34.10%	0.17%	0.00%	NA
Indica II	465	80.20%	19.80%	0.00%	0.00%	NA
Indica III	913	57.40%	42.50%	0.11%	0.00%	NA
Indica Intermediate	786	57.90%	42.00%	0.13%	0.00%	NA
Temperate Japonica	767	98.40%	1.60%	0.00%	0.00%	NA
Tropical Japonica	504	93.30%	6.70%	0.00%	0.00%	NA
Japonica Intermediate	241	98.30%	1.70%	0.00%	0.00%	NA
VI/Aromatic	96	100.00%	0.00%	0.00%	0.00%	NA
Intermediate	90	88.90%	11.10%	0.00%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1125401366	G -> T	LOC_Os11g42160.1	downstream_gene_variant ; 2062.0bp to feature; MODIFIER	silent_mutation	Average:29.758; most accessible tissue: Callus, score: 47.571	N	N	N	N
vg1125401366	G -> T	LOC_Os11g42170.1	downstream_gene_variant ; 689.0bp to feature; MODIFIER	silent_mutation	Average:29.758; most accessible tissue: Callus, score: 47.571	N	N	N	N
vg1125401366	G -> T	LOC_Os11g42180.1	downstream_gene_variant ; 4722.0bp to feature; MODIFIER	silent_mutation	Average:29.758; most accessible tissue: Callus, score: 47.571	N	N	N	N
vg1125401366	G -> T	LOC_Os11g42170-LOC_Os11g42180	intergenic_region ; MODIFIER	silent_mutation	Average:29.758; most accessible tissue: Callus, score: 47.571	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1125401366	1.42E-06	2.02E-17	mr1133	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125401366	3.66E-06	2.09E-10	mr1133	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125401366	NA	1.59E-07	mr1667	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125401366	NA	5.35E-18	mr1133_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125401366	NA	1.26E-09	mr1133_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125401366	NA	2.06E-06	mr1553_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125401366	NA	8.21E-06	mr1662_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125401366	NA	8.25E-12	mr1667_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125401366	NA	2.22E-07	mr1667_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251