\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1125393107:

Variant ID: vg1125393107 (JBrowse)Variation Type: SNP
Chromosome: chr11Position: 25393107
Reference Allele: TAlternative Allele: C
Primary Allele: TSecondary Allele: C

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.94, C: 0.06, others allele: 0.00, population size: 90. )

Flanking Sequence (100 bp) in Reference Genome:


AATTTTACAAAATTTATGATATGCCACCCTGATCCATATGTCATTGACTCATGTGGATTCTACATGACATTGAGATACGTGTGGCATATCTTAAATTTTG[T/C]
AAATATAGGGTGGCATGGTTCCAACAAACCCTTATATTAATACAAACTTTAATATGATACATAGTACAGATAAGATGATCTATGTAACCGATAGCTAAAT

Reverse complement sequence

ATTTAGCTATCGGTTACATAGATCATCTTATCTGTACTATGTATCATATTAAAGTTTGTATTAATATAAGGGTTTGTTGGAACCATGCCACCCTATATTT[A/G]
CAAAATTTAAGATATGCCACACGTATCTCAATGTCATGTAGAATCCACATGAGTCAATGACATATGGATCAGGGTGGCATATCATAAATTTTGTAAAATT

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 38.60% 0.50% 7.83% 53.07% NA
All Indica  2759 17.60% 0.50% 8.95% 72.89% NA
All Japonica  1512 66.40% 0.30% 6.68% 26.65% NA
Aus  269 76.60% 1.10% 5.20% 17.10% NA
Indica I  595 13.10% 0.00% 10.76% 76.13% NA
Indica II  465 40.00% 0.00% 8.39% 51.61% NA
Indica III  913 6.70% 1.30% 10.41% 81.60% NA
Indica Intermediate  786 20.50% 0.40% 6.23% 72.90% NA
Temperate Japonica  767 68.10% 0.00% 9.39% 22.56% NA
Tropical Japonica  504 64.10% 0.60% 2.38% 32.94% NA
Japonica Intermediate  241 66.00% 0.40% 7.05% 26.56% NA
VI/Aromatic  96 97.90% 0.00% 0.00% 2.08% NA
Intermediate  90 37.80% 2.20% 8.89% 51.11% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1125393107 T -> DEL N N silent_mutation Average:51.9; most accessible tissue: Zhenshan97 root, score: 78.911 N N N N
vg1125393107 T -> C LOC_Os11g42160.1 upstream_gene_variant ; 1064.0bp to feature; MODIFIER silent_mutation Average:51.9; most accessible tissue: Zhenshan97 root, score: 78.911 N N N N
vg1125393107 T -> C LOC_Os11g42150-LOC_Os11g42160 intergenic_region ; MODIFIER silent_mutation Average:51.9; most accessible tissue: Zhenshan97 root, score: 78.911 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1125393107 3.75E-10 1.43E-22 mr1133 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125393107 2.85E-07 2.45E-10 mr1133 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125393107 NA 2.31E-06 mr1191 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125393107 1.32E-06 NA mr1238 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125393107 4.04E-07 6.84E-12 mr1644 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125393107 2.72E-07 2.08E-10 mr1644 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125393107 6.39E-07 3.96E-14 mr1667 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125393107 8.13E-07 5.36E-08 mr1667 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125393107 NA 8.55E-07 mr1696 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125393107 4.91E-06 5.22E-07 mr1925 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125393107 7.68E-06 6.53E-11 mr1945 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125393107 9.82E-07 1.16E-18 mr1133_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125393107 NA 1.76E-07 mr1133_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125393107 NA 9.25E-14 mr1191_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125393107 NA 3.85E-09 mr1191_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125393107 7.53E-07 NA mr1238_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125393107 3.26E-06 NA mr1484_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125393107 1.42E-06 1.83E-06 mr1662_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125393107 NA 1.96E-12 mr1667_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125393107 NA 3.95E-06 mr1667_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125393107 3.23E-07 NA mr1841_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125393107 NA 1.78E-11 mr1850_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125393107 NA 1.13E-06 mr1875_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125393107 NA 3.45E-06 mr1931_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251