Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1125385406:

Variant ID: vg1125385406 (JBrowse)	Variation Type: INDEL
Chromosome: chr11	Position: 25385406
Reference Allele: GT	Alternative Allele: AT,G
Primary Allele: GT	Secondary Allele: AT

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

CATAAGTCTTCTCGGGAATTCATTTATTGTGACCTTCGAGCTAGCCTATATACTGTAAACTCCCAAGACCTTTCATTCTCATCTAGAAGGGTTGTTCCTA[GT/AT,G]
ATAAATATCTCCTATGTTTTATCATTTGAAAGACTTTTGACAATGAAAATATGAACCCCTTTTGTTTAGTTGTGTGCTAATAAATTCAAAGAGAGATCTA

Reverse complement sequence

TAGATCTCTCTTTGAATTTATTAGCACACAACTAAACAAAAGGGGTTCATATTTTCATTGTCAAAAGTCTTTCAAATGATAAAACATAGGAGATATTTAT[AC/AT,C]
TAGGAACAACCCTTCTAGATGAGAATGAAAGGTCTTGGGAGTTTACAGTATATAGGCTAGCTCGAAGGTCACAATAAATGAATTCCCGAGAAGACTTATG

Allele Frequencies:

Populations	Population Size	Frequency of GT(primary allele)	Frequency of AT(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	57.90%	42.10%	0.04%	0.00%	NA
All Indica	2759	37.70%	62.30%	0.04%	0.00%	NA
All Japonica	1512	86.60%	13.40%	0.00%	0.00%	NA
Aus	269	85.90%	14.10%	0.00%	0.00%	NA
Indica I	595	58.70%	41.20%	0.17%	0.00%	NA
Indica II	465	75.30%	24.70%	0.00%	0.00%	NA
Indica III	913	7.40%	92.60%	0.00%	0.00%	NA
Indica Intermediate	786	34.60%	65.40%	0.00%	0.00%	NA
Temperate Japonica	767	97.50%	2.50%	0.00%	0.00%	NA
Tropical Japonica	504	69.80%	30.20%	0.00%	0.00%	NA
Japonica Intermediate	241	86.70%	13.30%	0.00%	0.00%	NA
VI/Aromatic	96	100.00%	0.00%	0.00%	0.00%	NA
Intermediate	90	66.70%	32.20%	1.11%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1125385406	GT -> AT	LOC_Os11g42140.1	upstream_gene_variant ; 3442.0bp to feature; MODIFIER	silent_mutation	Average:52.567; most accessible tissue: Zhenshan97 panicle, score: 71.253	N	N	N	N
vg1125385406	GT -> AT	LOC_Os11g42150.1	downstream_gene_variant ; 222.0bp to feature; MODIFIER	silent_mutation	Average:52.567; most accessible tissue: Zhenshan97 panicle, score: 71.253	N	N	N	N
vg1125385406	GT -> AT	LOC_Os11g42150-LOC_Os11g42160	intergenic_region ; MODIFIER	silent_mutation	Average:52.567; most accessible tissue: Zhenshan97 panicle, score: 71.253	N	N	N	N
vg1125385406	GT -> G	LOC_Os11g42140.1	upstream_gene_variant ; 3443.0bp to feature; MODIFIER	N	Average:52.567; most accessible tissue: Zhenshan97 panicle, score: 71.253	N	N	N	N
vg1125385406	GT -> G	LOC_Os11g42150.1	downstream_gene_variant ; 223.0bp to feature; MODIFIER	N	Average:52.567; most accessible tissue: Zhenshan97 panicle, score: 71.253	N	N	N	N
vg1125385406	GT -> G	LOC_Os11g42150-LOC_Os11g42160	intergenic_region ; MODIFIER	N	Average:52.567; most accessible tissue: Zhenshan97 panicle, score: 71.253	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1125385406	NA	2.48E-06	mr1063	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125385406	6.05E-11	5.82E-30	mr1133	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125385406	5.15E-08	2.24E-18	mr1133	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125385406	3.04E-16	2.21E-15	mr1662	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125385406	4.91E-11	4.48E-13	mr1662	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125385406	3.65E-07	3.54E-16	mr1667	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125385406	3.34E-06	4.12E-11	mr1667	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125385406	NA	8.55E-07	mr1696	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125385406	4.91E-06	5.22E-07	mr1925	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125385406	3.61E-08	8.09E-26	mr1133_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125385406	NA	2.97E-15	mr1133_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125385406	2.01E-19	3.55E-16	mr1662_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125385406	7.76E-13	3.11E-15	mr1662_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125385406	1.42E-06	1.83E-06	mr1662_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125385406	1.06E-06	2.89E-16	mr1667_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125385406	9.43E-06	3.75E-11	mr1667_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251