\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1125385406:

Variant ID: vg1125385406 (JBrowse)Variation Type: INDEL
Chromosome: chr11Position: 25385406
Reference Allele: GTAlternative Allele: AT,G
Primary Allele: GTSecondary Allele: AT

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


CATAAGTCTTCTCGGGAATTCATTTATTGTGACCTTCGAGCTAGCCTATATACTGTAAACTCCCAAGACCTTTCATTCTCATCTAGAAGGGTTGTTCCTA[GT/AT,G]
ATAAATATCTCCTATGTTTTATCATTTGAAAGACTTTTGACAATGAAAATATGAACCCCTTTTGTTTAGTTGTGTGCTAATAAATTCAAAGAGAGATCTA

Reverse complement sequence

TAGATCTCTCTTTGAATTTATTAGCACACAACTAAACAAAAGGGGTTCATATTTTCATTGTCAAAAGTCTTTCAAATGATAAAACATAGGAGATATTTAT[AC/AT,C]
TAGGAACAACCCTTCTAGATGAGAATGAAAGGTCTTGGGAGTTTACAGTATATAGGCTAGCTCGAAGGTCACAATAAATGAATTCCCGAGAAGACTTATG

Allele Frequencies:

Populations Population SizeFrequency of GT(primary allele) Frequency of AT(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 57.90% 42.10% 0.04% 0.00% NA
All Indica  2759 37.70% 62.30% 0.04% 0.00% NA
All Japonica  1512 86.60% 13.40% 0.00% 0.00% NA
Aus  269 85.90% 14.10% 0.00% 0.00% NA
Indica I  595 58.70% 41.20% 0.17% 0.00% NA
Indica II  465 75.30% 24.70% 0.00% 0.00% NA
Indica III  913 7.40% 92.60% 0.00% 0.00% NA
Indica Intermediate  786 34.60% 65.40% 0.00% 0.00% NA
Temperate Japonica  767 97.50% 2.50% 0.00% 0.00% NA
Tropical Japonica  504 69.80% 30.20% 0.00% 0.00% NA
Japonica Intermediate  241 86.70% 13.30% 0.00% 0.00% NA
VI/Aromatic  96 100.00% 0.00% 0.00% 0.00% NA
Intermediate  90 66.70% 32.20% 1.11% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1125385406 GT -> AT LOC_Os11g42140.1 upstream_gene_variant ; 3442.0bp to feature; MODIFIER silent_mutation Average:52.567; most accessible tissue: Zhenshan97 panicle, score: 71.253 N N N N
vg1125385406 GT -> AT LOC_Os11g42150.1 downstream_gene_variant ; 222.0bp to feature; MODIFIER silent_mutation Average:52.567; most accessible tissue: Zhenshan97 panicle, score: 71.253 N N N N
vg1125385406 GT -> AT LOC_Os11g42150-LOC_Os11g42160 intergenic_region ; MODIFIER silent_mutation Average:52.567; most accessible tissue: Zhenshan97 panicle, score: 71.253 N N N N
vg1125385406 GT -> G LOC_Os11g42140.1 upstream_gene_variant ; 3443.0bp to feature; MODIFIER N Average:52.567; most accessible tissue: Zhenshan97 panicle, score: 71.253 N N N N
vg1125385406 GT -> G LOC_Os11g42150.1 downstream_gene_variant ; 223.0bp to feature; MODIFIER N Average:52.567; most accessible tissue: Zhenshan97 panicle, score: 71.253 N N N N
vg1125385406 GT -> G LOC_Os11g42150-LOC_Os11g42160 intergenic_region ; MODIFIER N Average:52.567; most accessible tissue: Zhenshan97 panicle, score: 71.253 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1125385406 NA 2.48E-06 mr1063 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125385406 6.05E-11 5.82E-30 mr1133 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125385406 5.15E-08 2.24E-18 mr1133 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125385406 3.04E-16 2.21E-15 mr1662 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125385406 4.91E-11 4.48E-13 mr1662 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125385406 3.65E-07 3.54E-16 mr1667 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125385406 3.34E-06 4.12E-11 mr1667 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125385406 NA 8.55E-07 mr1696 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125385406 4.91E-06 5.22E-07 mr1925 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125385406 3.61E-08 8.09E-26 mr1133_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125385406 NA 2.97E-15 mr1133_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125385406 2.01E-19 3.55E-16 mr1662_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125385406 7.76E-13 3.11E-15 mr1662_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125385406 1.42E-06 1.83E-06 mr1662_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125385406 1.06E-06 2.89E-16 mr1667_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125385406 9.43E-06 3.75E-11 mr1667_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251