Variant ID: vg1125345786 (JBrowse) | Variation Type: SNP |
Chromosome: chr11 | Position: 25345786 |
Reference Allele: A | Alternative Allele: G |
Primary Allele: A | Secondary Allele: G |
Inferred Ancestral Allele: Not determined.
ATTAAATAGCTATCTCATTATCTTATAATACTTTAAAAGACCAAACCTTATCATCCTCGTGTTTTTAATTATATAGTTTTTAAAAGTCACACCAGTTGCT[A/G]
CCCCTTATATCATCTCCTTCTTTATTTGCTTGCTCGATCTACCACTATTTCTATTCATTCTTCTTAGAACCTTTAAAAATTGGATTTCATAGTTTTTAGA
TCTAAAAACTATGAAATCCAATTTTTAAAGGTTCTAAGAAGAATGAATAGAAATAGTGGTAGATCGAGCAAGCAAATAAAGAAGGAGATGATATAAGGGG[T/C]
AGCAACTGGTGTGACTTTTAAAAACTATATAATTAAAAACACGAGGATGATAAGGTTTGGTCTTTTAAAGTATTATAAGATAATGAGATAGCTATTTAAT
Populations | Population Size | Frequency of A(primary allele) | Frequency of G(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
---|---|---|---|---|---|---|
All | 4726 | 58.20% | 0.30% | 3.36% | 38.15% | NA |
All Indica | 2759 | 60.80% | 0.30% | 4.13% | 34.80% | NA |
All Japonica | 1512 | 52.10% | 0.40% | 2.18% | 45.37% | NA |
Aus | 269 | 65.10% | 0.00% | 3.35% | 31.60% | NA |
Indica I | 595 | 49.90% | 0.20% | 7.06% | 42.86% | NA |
Indica II | 465 | 78.90% | 0.00% | 1.94% | 19.14% | NA |
Indica III | 913 | 60.00% | 0.10% | 3.29% | 36.58% | NA |
Indica Intermediate | 786 | 59.20% | 0.80% | 4.20% | 35.88% | NA |
Temperate Japonica | 767 | 59.80% | 0.00% | 1.69% | 38.46% | NA |
Tropical Japonica | 504 | 43.30% | 1.00% | 1.98% | 53.77% | NA |
Japonica Intermediate | 241 | 45.60% | 0.40% | 4.15% | 49.79% | NA |
VI/Aromatic | 96 | 63.50% | 0.00% | 1.04% | 35.42% | NA |
Intermediate | 90 | 55.60% | 0.00% | 2.22% | 42.22% | NA |
Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
---|---|---|---|---|---|---|---|---|---|
vg1125345786 | A -> DEL | N | N | silent_mutation | Average:12.715; most accessible tissue: Callus, score: 35.526 | N | N | N | N |
vg1125345786 | A -> G | LOC_Os11g42090.1 | upstream_gene_variant ; 439.0bp to feature; MODIFIER | silent_mutation | Average:12.715; most accessible tissue: Callus, score: 35.526 | N | N | N | N |
vg1125345786 | A -> G | LOC_Os11g42090-LOC_Os11g42100 | intergenic_region ; MODIFIER | silent_mutation | Average:12.715; most accessible tissue: Callus, score: 35.526 | N | N | N | N |
Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
---|---|---|---|---|---|---|
vg1125345786 | NA | 3.28E-06 | mr1125 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg1125345786 | NA | 2.24E-06 | mr1448 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg1125345786 | 5.24E-08 | 2.55E-11 | mr1125_2 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |