Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923).

Detailed information for vg1125345786:

Variant ID: vg1125345786 (JBrowse)	Variation Type: SNP
Chromosome: chr11	Position: 25345786
Reference Allele: A	Alternative Allele: G
Primary Allele: A	Secondary Allele: G

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

ATTAAATAGCTATCTCATTATCTTATAATACTTTAAAAGACCAAACCTTATCATCCTCGTGTTTTTAATTATATAGTTTTTAAAAGTCACACCAGTTGCT[A/G]
CCCCTTATATCATCTCCTTCTTTATTTGCTTGCTCGATCTACCACTATTTCTATTCATTCTTCTTAGAACCTTTAAAAATTGGATTTCATAGTTTTTAGA

Reverse complement sequence

TCTAAAAACTATGAAATCCAATTTTTAAAGGTTCTAAGAAGAATGAATAGAAATAGTGGTAGATCGAGCAAGCAAATAAAGAAGGAGATGATATAAGGGG[T/C]
AGCAACTGGTGTGACTTTTAAAAACTATATAATTAAAAACACGAGGATGATAAGGTTTGGTCTTTTAAAGTATTATAAGATAATGAGATAGCTATTTAAT

Allele Frequencies:

Populations	Population Size	Frequency of A(primary allele)	Frequency of G(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	58.20%	0.30%	3.36%	38.15%	NA
All Indica	2759	60.80%	0.30%	4.13%	34.80%	NA
All Japonica	1512	52.10%	0.40%	2.18%	45.37%	NA
Aus	269	65.10%	0.00%	3.35%	31.60%	NA
Indica I	595	49.90%	0.20%	7.06%	42.86%	NA
Indica II	465	78.90%	0.00%	1.94%	19.14%	NA
Indica III	913	60.00%	0.10%	3.29%	36.58%	NA
Indica Intermediate	786	59.20%	0.80%	4.20%	35.88%	NA
Temperate Japonica	767	59.80%	0.00%	1.69%	38.46%	NA
Tropical Japonica	504	43.30%	1.00%	1.98%	53.77%	NA
Japonica Intermediate	241	45.60%	0.40%	4.15%	49.79%	NA
VI/Aromatic	96	63.50%	0.00%	1.04%	35.42%	NA
Intermediate	90	55.60%	0.00%	2.22%	42.22%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1125345786	A -> DEL	N	N	silent_mutation	Average:12.715; most accessible tissue: Callus, score: 35.526	N	N	N	N
vg1125345786	A -> G	LOC_Os11g42090.1	upstream_gene_variant ; 439.0bp to feature; MODIFIER	silent_mutation	Average:12.715; most accessible tissue: Callus, score: 35.526	N	N	N	N
vg1125345786	A -> G	LOC_Os11g42090-LOC_Os11g42100	intergenic_region ; MODIFIER	silent_mutation	Average:12.715; most accessible tissue: Callus, score: 35.526	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1125345786	NA	3.28E-06	mr1125	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125345786	NA	2.24E-06	mr1448	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125345786	5.24E-08	2.55E-11	mr1125_2	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251