Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923).

Detailed information for vg1125297477:

Variant ID: vg1125297477 (JBrowse)	Variation Type: SNP
Chromosome: chr11	Position: 25297477
Reference Allele: A	Alternative Allele: C
Primary Allele: C	Secondary Allele: A

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.99, C: 0.01, others allele: 0.00, population size: 81. )

Flanking Sequence (100 bp) in Reference Genome:

CCTGGTTTAATTCCCCAAATTTTTTTCCCCAAAATATCACATCGAATATTTGGACACATACATATAGGGCAAAAAAATATAGATTAAAAAACTAATTACA[A/C]
CGTTAGGGGAGAAATCACGAAACAAATCTTTTAAGTCTAATTAGTCCATGATTAGGCTCAAAAGATTCGTCTCGTCGTTTCCAAGCGAGTTATGAAATTG

Reverse complement sequence

CAATTTCATAACTCGCTTGGAAACGACGAGACGAATCTTTTGAGCCTAATCATGGACTAATTAGACTTAAAAGATTTGTTTCGTGATTTCTCCCCTAACG[T/G]
TGTAATTAGTTTTTTAATCTATATTTTTTTGCCCTATATGTATGTGTCCAAATATTCGATGTGATATTTTGGGGAAAAAAATTTGGGGAATTAAACCAGG

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	41.90%	17.00%	0.53%	40.58%	NA
All Indica	2759	61.00%	5.30%	0.51%	33.13%	NA
All Japonica	1512	14.40%	34.90%	0.33%	50.46%	NA
Aus	269	17.50%	22.70%	1.49%	58.36%	NA
Indica I	595	42.50%	4.90%	0.34%	52.27%	NA
Indica II	465	27.10%	7.70%	2.15%	63.01%	NA
Indica III	913	86.60%	3.70%	0.00%	9.64%	NA
Indica Intermediate	786	65.40%	6.10%	0.25%	28.24%	NA
Temperate Japonica	767	2.70%	54.40%	0.13%	42.76%	NA
Tropical Japonica	504	31.50%	10.10%	0.40%	57.94%	NA
Japonica Intermediate	241	15.40%	24.50%	0.83%	59.34%	NA
VI/Aromatic	96	1.00%	53.10%	0.00%	45.83%	NA
Intermediate	90	35.60%	17.80%	2.22%	44.44%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1125297477	A -> DEL	N	N	silent_mutation	Average:48.045; most accessible tissue: Callus, score: 63.823	N	N	N	N
vg1125297477	A -> C	LOC_Os11g42040.1	upstream_gene_variant ; 3523.0bp to feature; MODIFIER	silent_mutation	Average:48.045; most accessible tissue: Callus, score: 63.823	N	N	N	N
vg1125297477	A -> C	LOC_Os11g42050.1	upstream_gene_variant ; 657.0bp to feature; MODIFIER	silent_mutation	Average:48.045; most accessible tissue: Callus, score: 63.823	N	N	N	N
vg1125297477	A -> C	LOC_Os11g42050-LOC_Os11g42060	intergenic_region ; MODIFIER	silent_mutation	Average:48.045; most accessible tissue: Callus, score: 63.823	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1125297477	NA	7.83E-11	mr1133	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125297477	NA	7.94E-07	mr1667	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125297477	NA	7.72E-08	mr1133_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125297477	NA	5.71E-06	mr1383_2	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125297477	NA	3.79E-06	mr1540_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125297477	NA	1.70E-06	mr1667_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125297477	NA	3.75E-06	mr1732_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251