\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).


Sorry, variation is wrong, please check.

Sorry, variation is wrong, please check.

Detailed information for vg1125297477:

Variant ID: vg1125297477 (JBrowse)Variation Type: SNP
Chromosome: chr11Position: 25297477
Reference Allele: AAlternative Allele: C
Primary Allele: CSecondary Allele: A

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.99, C: 0.01, others allele: 0.00, population size: 81. )

Flanking Sequence (100 bp) in Reference Genome:


CCTGGTTTAATTCCCCAAATTTTTTTCCCCAAAATATCACATCGAATATTTGGACACATACATATAGGGCAAAAAAATATAGATTAAAAAACTAATTACA[A/C]
CGTTAGGGGAGAAATCACGAAACAAATCTTTTAAGTCTAATTAGTCCATGATTAGGCTCAAAAGATTCGTCTCGTCGTTTCCAAGCGAGTTATGAAATTG

Reverse complement sequence

CAATTTCATAACTCGCTTGGAAACGACGAGACGAATCTTTTGAGCCTAATCATGGACTAATTAGACTTAAAAGATTTGTTTCGTGATTTCTCCCCTAACG[T/G]
TGTAATTAGTTTTTTAATCTATATTTTTTTGCCCTATATGTATGTGTCCAAATATTCGATGTGATATTTTGGGGAAAAAAATTTGGGGAATTAAACCAGG

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 41.90% 17.00% 0.53% 40.58% NA
All Indica  2759 61.00% 5.30% 0.51% 33.13% NA
All Japonica  1512 14.40% 34.90% 0.33% 50.46% NA
Aus  269 17.50% 22.70% 1.49% 58.36% NA
Indica I  595 42.50% 4.90% 0.34% 52.27% NA
Indica II  465 27.10% 7.70% 2.15% 63.01% NA
Indica III  913 86.60% 3.70% 0.00% 9.64% NA
Indica Intermediate  786 65.40% 6.10% 0.25% 28.24% NA
Temperate Japonica  767 2.70% 54.40% 0.13% 42.76% NA
Tropical Japonica  504 31.50% 10.10% 0.40% 57.94% NA
Japonica Intermediate  241 15.40% 24.50% 0.83% 59.34% NA
VI/Aromatic  96 1.00% 53.10% 0.00% 45.83% NA
Intermediate  90 35.60% 17.80% 2.22% 44.44% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1125297477 A -> DEL N N silent_mutation Average:48.045; most accessible tissue: Callus, score: 63.823 N N N N
vg1125297477 A -> C LOC_Os11g42040.1 upstream_gene_variant ; 3523.0bp to feature; MODIFIER silent_mutation Average:48.045; most accessible tissue: Callus, score: 63.823 N N N N
vg1125297477 A -> C LOC_Os11g42050.1 upstream_gene_variant ; 657.0bp to feature; MODIFIER silent_mutation Average:48.045; most accessible tissue: Callus, score: 63.823 N N N N
vg1125297477 A -> C LOC_Os11g42050-LOC_Os11g42060 intergenic_region ; MODIFIER silent_mutation Average:48.045; most accessible tissue: Callus, score: 63.823 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1125297477 NA 7.83E-11 mr1133 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125297477 NA 7.94E-07 mr1667 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125297477 NA 7.72E-08 mr1133_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125297477 NA 5.71E-06 mr1383_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125297477 NA 3.79E-06 mr1540_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125297477 NA 1.70E-06 mr1667_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125297477 NA 3.75E-06 mr1732_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251