| Variant ID: vg1125234228 (JBrowse) | Variation Type: INDEL |
| Chromosome: chr11 | Position: 25234228 |
| Reference Allele: GA | Alternative Allele: AA,G,GAA |
| Primary Allele: AA | Secondary Allele: GA |
Inferred Ancestral Allele: Not determined.
ATTAGACATAGCTACATTATCTGCTTCTATCGTTCGTGTCCTCCAAAGAACTGATCAGAATAGTAGTAGCACACGCTGAGTTGCAGGTAATTTCAGGAAG[GA/AA,G,GAA]
AAAAAAAAAACCTTGGGTCAGACCACCGTTGTCACTGTGGGGTAAACTCCAGAAGACAGAGAAAGCTAAAGATATGTCCTAGGTATGTTTTCTCTAGGAA
TTCCTAGAGAAAACATACCTAGGACATATCTTTAGCTTTCTCTGTCTTCTGGAGTTTACCCCACAGTGACAACGGTGGTCTGACCCAAGGTTTTTTTTTT[TC/TT,C,TTC]
CTTCCTGAAATTACCTGCAACTCAGCGTGTGCTACTACTATTCTGATCAGTTCTTTGGAGGACACGAACGATAGAAGCAGATAATGTAGCTATGTCTAAT
| Populations | Population Size | Frequency of AA(primary allele) | Frequency of GA(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 30.00% | 27.30% | 1.67% | 39.76% | G: 1.21% |
| All Indica | 2759 | 37.10% | 3.50% | 1.63% | 57.19% | G: 0.54% |
| All Japonica | 1512 | 19.30% | 65.20% | 0.99% | 14.29% | G: 0.20% |
| Aus | 269 | 24.90% | 35.70% | 5.58% | 21.93% | G: 11.90% |
| Indica I | 595 | 34.80% | 2.50% | 1.01% | 61.68% | NA |
| Indica II | 465 | 40.20% | 4.10% | 3.66% | 51.83% | G: 0.22% |
| Indica III | 913 | 41.00% | 2.50% | 0.99% | 55.09% | G: 0.44% |
| Indica Intermediate | 786 | 32.60% | 5.10% | 1.65% | 59.41% | G: 1.27% |
| Temperate Japonica | 767 | 4.00% | 93.00% | 0.26% | 2.35% | G: 0.39% |
| Tropical Japonica | 504 | 46.40% | 20.80% | 1.39% | 31.35% | NA |
| Japonica Intermediate | 241 | 11.20% | 69.70% | 2.49% | 16.60% | NA |
| VI/Aromatic | 96 | 8.30% | 87.50% | 1.04% | 1.04% | G: 2.08% |
| Intermediate | 90 | 31.10% | 32.20% | 3.33% | 27.78% | G: 5.56% |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1125234228 | GA -> GAA | LOC_Os11g41950.1 | upstream_gene_variant ; 3307.0bp to feature; MODIFIER | N | Average:31.075; most accessible tissue: Callus, score: 91.462 | N | N | N | N |
| vg1125234228 | GA -> GAA | LOC_Os11g41960.1 | downstream_gene_variant ; 1501.0bp to feature; MODIFIER | N | Average:31.075; most accessible tissue: Callus, score: 91.462 | N | N | N | N |
| vg1125234228 | GA -> GAA | LOC_Os11g41970.1 | downstream_gene_variant ; 592.0bp to feature; MODIFIER | N | Average:31.075; most accessible tissue: Callus, score: 91.462 | N | N | N | N |
| vg1125234228 | GA -> GAA | LOC_Os11g41960-LOC_Os11g41970 | intergenic_region ; MODIFIER | N | Average:31.075; most accessible tissue: Callus, score: 91.462 | N | N | N | N |
| vg1125234228 | GA -> AA | LOC_Os11g41950.1 | upstream_gene_variant ; 3305.0bp to feature; MODIFIER | silent_mutation | Average:31.075; most accessible tissue: Callus, score: 91.462 | N | N | N | N |
| vg1125234228 | GA -> AA | LOC_Os11g41960.1 | downstream_gene_variant ; 1499.0bp to feature; MODIFIER | silent_mutation | Average:31.075; most accessible tissue: Callus, score: 91.462 | N | N | N | N |
| vg1125234228 | GA -> AA | LOC_Os11g41970.1 | downstream_gene_variant ; 594.0bp to feature; MODIFIER | silent_mutation | Average:31.075; most accessible tissue: Callus, score: 91.462 | N | N | N | N |
| vg1125234228 | GA -> AA | LOC_Os11g41960-LOC_Os11g41970 | intergenic_region ; MODIFIER | silent_mutation | Average:31.075; most accessible tissue: Callus, score: 91.462 | N | N | N | N |
| vg1125234228 | GA -> DEL | N | N | silent_mutation | Average:31.075; most accessible tissue: Callus, score: 91.462 | N | N | N | N |
| vg1125234228 | GA -> G | LOC_Os11g41950.1 | upstream_gene_variant ; 3306.0bp to feature; MODIFIER | silent_mutation | Average:31.075; most accessible tissue: Callus, score: 91.462 | N | N | N | N |
| vg1125234228 | GA -> G | LOC_Os11g41960.1 | downstream_gene_variant ; 1500.0bp to feature; MODIFIER | silent_mutation | Average:31.075; most accessible tissue: Callus, score: 91.462 | N | N | N | N |
| vg1125234228 | GA -> G | LOC_Os11g41970.1 | downstream_gene_variant ; 593.0bp to feature; MODIFIER | silent_mutation | Average:31.075; most accessible tissue: Callus, score: 91.462 | N | N | N | N |
| vg1125234228 | GA -> G | LOC_Os11g41960-LOC_Os11g41970 | intergenic_region ; MODIFIER | silent_mutation | Average:31.075; most accessible tissue: Callus, score: 91.462 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1125234228 | 1.12E-15 | 2.49E-23 | mr1191 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1125234228 | 1.09E-17 | 3.61E-20 | mr1191 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1125234228 | NA | 6.21E-06 | mr1238 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1125234228 | NA | 1.52E-06 | mr1380 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1125234228 | NA | 2.23E-07 | mr1561 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1125234228 | 5.31E-20 | 9.08E-29 | mr1644 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1125234228 | 1.13E-21 | 7.32E-24 | mr1644 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1125234228 | 3.24E-06 | NA | mr1662 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1125234228 | NA | 1.54E-06 | mr1662 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1125234228 | NA | 1.79E-07 | mr1723 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1125234228 | NA | 8.61E-06 | mr1900 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1125234228 | NA | 1.68E-06 | mr1908 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1125234228 | NA | 1.73E-06 | mr1937 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1125234228 | 1.10E-16 | 3.00E-32 | mr1191_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1125234228 | 2.10E-19 | 4.66E-25 | mr1191_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1125234228 | NA | 1.34E-06 | mr1662_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1125234228 | NA | 9.45E-06 | mr1662_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |