\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1125233498:

Variant ID: vg1125233498 (JBrowse)Variation Type: SNP
Chromosome: chr11Position: 25233498
Reference Allele: AAlternative Allele: G
Primary Allele: ASecondary Allele: G

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.98, G: 0.03, others allele: 0.00, population size: 281. )

Flanking Sequence (100 bp) in Reference Genome:


ATAGAGTAGTTATCACTTACTGGTATGGTGCCCGTGCGTTGCGATGGGACAATAAAAATATATGCACACGGGGTAAAATTATGTTAAATAGTTTGAGAGT[A/G]
CGTATATTGTACACGATCCCTATCACATATCTCCCCTATAAATACATTGCCATTGTCATAAATCATCACCAATTCACGACAAACAGGATCGCGATTGCCC

Reverse complement sequence

GGGCAATCGCGATCCTGTTTGTCGTGAATTGGTGATGATTTATGACAATGGCAATGTATTTATAGGGGAGATATGTGATAGGGATCGTGTACAATATACG[T/C]
ACTCTCAAACTATTTAACATAATTTTACCCCGTGTGCATATATTTTTATTGTCCCATCGCAACGCACGGGCACCATACCAGTAAGTGATAACTACTCTAT

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 91.30% 8.60% 0.04% 0.00% NA
All Indica  2759 86.60% 13.30% 0.07% 0.00% NA
All Japonica  1512 99.60% 0.40% 0.00% 0.00% NA
Aus  269 93.70% 6.30% 0.00% 0.00% NA
Indica I  595 67.40% 32.60% 0.00% 0.00% NA
Indica II  465 79.10% 20.60% 0.22% 0.00% NA
Indica III  913 98.00% 1.90% 0.11% 0.00% NA
Indica Intermediate  786 92.40% 7.60% 0.00% 0.00% NA
Temperate Japonica  767 99.20% 0.80% 0.00% 0.00% NA
Tropical Japonica  504 100.00% 0.00% 0.00% 0.00% NA
Japonica Intermediate  241 100.00% 0.00% 0.00% 0.00% NA
VI/Aromatic  96 92.70% 7.30% 0.00% 0.00% NA
Intermediate  90 87.80% 12.20% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1125233498 A -> G LOC_Os11g41950.1 upstream_gene_variant ; 2575.0bp to feature; MODIFIER silent_mutation Average:52.998; most accessible tissue: Callus, score: 83.415 N N N N
vg1125233498 A -> G LOC_Os11g41960.1 downstream_gene_variant ; 769.0bp to feature; MODIFIER silent_mutation Average:52.998; most accessible tissue: Callus, score: 83.415 N N N N
vg1125233498 A -> G LOC_Os11g41970.1 downstream_gene_variant ; 1324.0bp to feature; MODIFIER silent_mutation Average:52.998; most accessible tissue: Callus, score: 83.415 N N N N
vg1125233498 A -> G LOC_Os11g41960-LOC_Os11g41970 intergenic_region ; MODIFIER silent_mutation Average:52.998; most accessible tissue: Callus, score: 83.415 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1125233498 1.55E-20 2.68E-30 mr1191 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125233498 4.12E-19 4.69E-22 mr1191 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125233498 NA 1.98E-06 mr1530 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125233498 3.60E-24 9.13E-34 mr1644 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125233498 3.75E-21 2.39E-24 mr1644 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125233498 2.40E-10 1.55E-12 mr1662 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125233498 2.75E-09 1.36E-12 mr1662 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125233498 NA 2.96E-07 mr1745 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125233498 1.80E-26 1.15E-50 mr1191_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125233498 6.97E-23 3.37E-35 mr1191_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125233498 NA 8.59E-07 mr1530_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125233498 2.29E-07 9.30E-13 mr1662_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125233498 8.58E-08 2.26E-13 mr1662_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125233498 NA 3.83E-09 mr1745_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125233498 NA 2.80E-06 mr1875_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125233498 NA 4.05E-06 mr1908_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251