\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1125231256:

Variant ID: vg1125231256 (JBrowse)Variation Type: INDEL
Chromosome: chr11Position: 25231256
Reference Allele: GAlternative Allele: A,GGCA
Primary Allele: ASecondary Allele: G

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


GACGCCAGCGGCGCCGGGACGCTCGAGCTCGCTCCTAACGGAGATGACTAACCCATCTCTCTCGTTTTTCGTGCGCACGCTTTTCAAATTTCTAAACGGC[G/A,GGCA]
TGATTTATACAAAAAGTTTATATATGAAAGTTGTTTTAGAAAAACATATTAATCCAATTTTTTTAAAAAAGTTAATGCTTAATTAATCATACAATAATAT

Reverse complement sequence

ATATTATTGTATGATTAATTAAGCATTAACTTTTTTAAAAAAATTGGATTAATATGTTTTTCTAAAACAACTTTCATATATAAACTTTTTGTATAAATCA[C/T,TGCC]
GCCGTTTAGAAATTTGAAAAGCGTGCGCACGAAAAACGAGAGAGATGGGTTAGTCATCTCCGTTAGGAGCGAGCTCGAGCGTCCCGGCGCCGCTGGCGTC

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 31.30% 28.30% 0.74% 31.51% GGCA: 8.17%
All Indica  2759 36.80% 4.00% 0.98% 44.40% GGCA: 13.81%
All Japonica  1512 20.20% 66.80% 0.13% 12.63% GGCA: 0.20%
Aus  269 43.90% 35.70% 1.12% 19.33% NA
Indica I  595 35.10% 2.70% 1.01% 59.66% GGCA: 1.51%
Indica II  465 88.00% 2.80% 0.65% 5.81% GGCA: 2.80%
Indica III  913 9.70% 3.80% 1.20% 53.78% GGCA: 31.43%
Indica Intermediate  786 39.30% 5.90% 0.89% 44.78% GGCA: 9.16%
Temperate Japonica  767 3.80% 93.60% 0.13% 2.22% GGCA: 0.26%
Tropical Japonica  504 47.80% 23.40% 0.20% 28.37% GGCA: 0.20%
Japonica Intermediate  241 14.90% 72.20% 0.00% 12.86% NA
VI/Aromatic  96 9.40% 90.60% 0.00% 0.00% NA
Intermediate  90 34.40% 36.70% 3.33% 23.33% GGCA: 2.22%

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1125231256 G -> A LOC_Os11g41950.1 upstream_gene_variant ; 333.0bp to feature; MODIFIER silent_mutation Average:21.645; most accessible tissue: Callus, score: 79.924 N N N N
vg1125231256 G -> A LOC_Os11g41960.1 upstream_gene_variant ; 1036.0bp to feature; MODIFIER silent_mutation Average:21.645; most accessible tissue: Callus, score: 79.924 N N N N
vg1125231256 G -> A LOC_Os11g41940.1 downstream_gene_variant ; 3930.0bp to feature; MODIFIER silent_mutation Average:21.645; most accessible tissue: Callus, score: 79.924 N N N N
vg1125231256 G -> A LOC_Os11g41970.1 downstream_gene_variant ; 3566.0bp to feature; MODIFIER silent_mutation Average:21.645; most accessible tissue: Callus, score: 79.924 N N N N
vg1125231256 G -> A LOC_Os11g41950-LOC_Os11g41960 intergenic_region ; MODIFIER silent_mutation Average:21.645; most accessible tissue: Callus, score: 79.924 N N N N
vg1125231256 G -> DEL N N silent_mutation Average:21.645; most accessible tissue: Callus, score: 79.924 N N N N
vg1125231256 G -> GGCA LOC_Os11g41950.1 upstream_gene_variant ; 334.0bp to feature; MODIFIER silent_mutation Average:21.645; most accessible tissue: Callus, score: 79.924 N N N N
vg1125231256 G -> GGCA LOC_Os11g41960.1 upstream_gene_variant ; 1035.0bp to feature; MODIFIER silent_mutation Average:21.645; most accessible tissue: Callus, score: 79.924 N N N N
vg1125231256 G -> GGCA LOC_Os11g41940.1 downstream_gene_variant ; 3931.0bp to feature; MODIFIER silent_mutation Average:21.645; most accessible tissue: Callus, score: 79.924 N N N N
vg1125231256 G -> GGCA LOC_Os11g41970.1 downstream_gene_variant ; 3565.0bp to feature; MODIFIER silent_mutation Average:21.645; most accessible tissue: Callus, score: 79.924 N N N N
vg1125231256 G -> GGCA LOC_Os11g41950-LOC_Os11g41960 intergenic_region ; MODIFIER silent_mutation Average:21.645; most accessible tissue: Callus, score: 79.924 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1125231256 NA 2.06E-06 mr1069 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125231256 NA 1.56E-06 mr1130 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125231256 9.24E-09 2.99E-11 mr1191 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125231256 2.05E-12 5.15E-09 mr1191 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125231256 NA 5.53E-06 mr1238 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125231256 NA 1.03E-06 mr1441 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125231256 NA 1.04E-06 mr1503 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125231256 6.52E-11 6.98E-12 mr1644 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125231256 8.70E-14 9.39E-09 mr1644 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125231256 1.28E-11 9.08E-08 mr1662 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125231256 5.97E-07 NA mr1662 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125231256 NA 6.30E-07 mr1662 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125231256 NA 2.95E-07 mr1723 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125231256 NA 5.51E-06 mr1900 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125231256 NA 1.07E-06 mr1094_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125231256 NA 3.76E-07 mr1149_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125231256 1.35E-09 2.43E-14 mr1191_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125231256 2.91E-14 2.40E-09 mr1191_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125231256 NA 1.86E-08 mr1441_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125231256 NA 5.12E-06 mr1542_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125231256 8.51E-10 1.92E-09 mr1662_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125231256 6.23E-06 NA mr1662_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125231256 NA 4.22E-06 mr1662_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125231256 NA 3.39E-08 mr1861_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125231256 NA 1.70E-06 mr1933_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251