Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1125231256:

Variant ID: vg1125231256 (JBrowse)	Variation Type: INDEL
Chromosome: chr11	Position: 25231256
Reference Allele: G	Alternative Allele: A,GGCA
Primary Allele: A	Secondary Allele: G

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

GACGCCAGCGGCGCCGGGACGCTCGAGCTCGCTCCTAACGGAGATGACTAACCCATCTCTCTCGTTTTTCGTGCGCACGCTTTTCAAATTTCTAAACGGC[G/A,GGCA]
TGATTTATACAAAAAGTTTATATATGAAAGTTGTTTTAGAAAAACATATTAATCCAATTTTTTTAAAAAAGTTAATGCTTAATTAATCATACAATAATAT

Reverse complement sequence

ATATTATTGTATGATTAATTAAGCATTAACTTTTTTAAAAAAATTGGATTAATATGTTTTTCTAAAACAACTTTCATATATAAACTTTTTGTATAAATCA[C/T,TGCC]
GCCGTTTAGAAATTTGAAAAGCGTGCGCACGAAAAACGAGAGAGATGGGTTAGTCATCTCCGTTAGGAGCGAGCTCGAGCGTCCCGGCGCCGCTGGCGTC

Allele Frequencies:

Populations	Population Size	Frequency of A(primary allele)	Frequency of G(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	31.30%	28.30%	0.74%	31.51%	GGCA: 8.17%
All Indica	2759	36.80%	4.00%	0.98%	44.40%	GGCA: 13.81%
All Japonica	1512	20.20%	66.80%	0.13%	12.63%	GGCA: 0.20%
Aus	269	43.90%	35.70%	1.12%	19.33%	NA
Indica I	595	35.10%	2.70%	1.01%	59.66%	GGCA: 1.51%
Indica II	465	88.00%	2.80%	0.65%	5.81%	GGCA: 2.80%
Indica III	913	9.70%	3.80%	1.20%	53.78%	GGCA: 31.43%
Indica Intermediate	786	39.30%	5.90%	0.89%	44.78%	GGCA: 9.16%
Temperate Japonica	767	3.80%	93.60%	0.13%	2.22%	GGCA: 0.26%
Tropical Japonica	504	47.80%	23.40%	0.20%	28.37%	GGCA: 0.20%
Japonica Intermediate	241	14.90%	72.20%	0.00%	12.86%	NA
VI/Aromatic	96	9.40%	90.60%	0.00%	0.00%	NA
Intermediate	90	34.40%	36.70%	3.33%	23.33%	GGCA: 2.22%

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1125231256	G -> A	LOC_Os11g41950.1	upstream_gene_variant ; 333.0bp to feature; MODIFIER	silent_mutation	Average:21.645; most accessible tissue: Callus, score: 79.924	N	N	N	N
vg1125231256	G -> A	LOC_Os11g41960.1	upstream_gene_variant ; 1036.0bp to feature; MODIFIER	silent_mutation	Average:21.645; most accessible tissue: Callus, score: 79.924	N	N	N	N
vg1125231256	G -> A	LOC_Os11g41940.1	downstream_gene_variant ; 3930.0bp to feature; MODIFIER	silent_mutation	Average:21.645; most accessible tissue: Callus, score: 79.924	N	N	N	N
vg1125231256	G -> A	LOC_Os11g41970.1	downstream_gene_variant ; 3566.0bp to feature; MODIFIER	silent_mutation	Average:21.645; most accessible tissue: Callus, score: 79.924	N	N	N	N
vg1125231256	G -> A	LOC_Os11g41950-LOC_Os11g41960	intergenic_region ; MODIFIER	silent_mutation	Average:21.645; most accessible tissue: Callus, score: 79.924	N	N	N	N
vg1125231256	G -> DEL	N	N	silent_mutation	Average:21.645; most accessible tissue: Callus, score: 79.924	N	N	N	N
vg1125231256	G -> GGCA	LOC_Os11g41950.1	upstream_gene_variant ; 334.0bp to feature; MODIFIER	silent_mutation	Average:21.645; most accessible tissue: Callus, score: 79.924	N	N	N	N
vg1125231256	G -> GGCA	LOC_Os11g41960.1	upstream_gene_variant ; 1035.0bp to feature; MODIFIER	silent_mutation	Average:21.645; most accessible tissue: Callus, score: 79.924	N	N	N	N
vg1125231256	G -> GGCA	LOC_Os11g41940.1	downstream_gene_variant ; 3931.0bp to feature; MODIFIER	silent_mutation	Average:21.645; most accessible tissue: Callus, score: 79.924	N	N	N	N
vg1125231256	G -> GGCA	LOC_Os11g41970.1	downstream_gene_variant ; 3565.0bp to feature; MODIFIER	silent_mutation	Average:21.645; most accessible tissue: Callus, score: 79.924	N	N	N	N
vg1125231256	G -> GGCA	LOC_Os11g41950-LOC_Os11g41960	intergenic_region ; MODIFIER	silent_mutation	Average:21.645; most accessible tissue: Callus, score: 79.924	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1125231256	NA	2.06E-06	mr1069	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125231256	NA	1.56E-06	mr1130	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125231256	9.24E-09	2.99E-11	mr1191	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125231256	2.05E-12	5.15E-09	mr1191	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125231256	NA	5.53E-06	mr1238	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125231256	NA	1.03E-06	mr1441	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125231256	NA	1.04E-06	mr1503	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125231256	6.52E-11	6.98E-12	mr1644	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125231256	8.70E-14	9.39E-09	mr1644	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125231256	1.28E-11	9.08E-08	mr1662	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125231256	5.97E-07	NA	mr1662	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125231256	NA	6.30E-07	mr1662	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125231256	NA	2.95E-07	mr1723	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125231256	NA	5.51E-06	mr1900	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125231256	NA	1.07E-06	mr1094_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125231256	NA	3.76E-07	mr1149_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125231256	1.35E-09	2.43E-14	mr1191_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125231256	2.91E-14	2.40E-09	mr1191_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125231256	NA	1.86E-08	mr1441_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125231256	NA	5.12E-06	mr1542_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125231256	8.51E-10	1.92E-09	mr1662_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125231256	6.23E-06	NA	mr1662_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125231256	NA	4.22E-06	mr1662_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125231256	NA	3.39E-08	mr1861_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125231256	NA	1.70E-06	mr1933_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251