\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1125230308:

Variant ID: vg1125230308 (JBrowse)Variation Type: SNP
Chromosome: chr11Position: 25230308
Reference Allele: CAlternative Allele: G
Primary Allele: CSecondary Allele: G

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


AATTTAAACTTCGCTGAAACAATTTGGTACCGTGAGGTACGGTATCTCGAGATACTTTTTGATGTACTGGGGCATATCTCTTCCCTACACTAACTAATGC[C/G]
AACACATCATGATTAATCATCATATCTTTCTAACGCTTCCTCCTCCTGACAGGTTCTTCTTCACGGCGACTCCATTGCGGAACCTTCTCCGGCTAGGGGA

Reverse complement sequence

TCCCCTAGCCGGAGAAGGTTCCGCAATGGAGTCGCCGTGAAGAAGAACCTGTCAGGAGGAGGAAGCGTTAGAAAGATATGATGATTAATCATGATGTGTT[G/C]
GCATTAGTTAGTGTAGGGAAGAGATATGCCCCAGTACATCAAAAAGTATCTCGAGATACCGTACCTCACGGTACCAAATTGTTTCAGCGAAGTTTAAATT

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 88.00% 9.30% 0.66% 2.07% NA
All Indica  2759 86.40% 12.20% 0.33% 1.09% NA
All Japonica  1512 88.70% 5.70% 1.46% 4.17% NA
Aus  269 98.10% 1.90% 0.00% 0.00% NA
Indica I  595 93.10% 6.70% 0.17% 0.00% NA
Indica II  465 98.50% 0.20% 0.22% 1.08% NA
Indica III  913 78.40% 19.80% 0.22% 1.53% NA
Indica Intermediate  786 83.50% 14.50% 0.64% 1.40% NA
Temperate Japonica  767 99.20% 0.70% 0.13% 0.00% NA
Tropical Japonica  504 72.60% 12.70% 3.17% 11.51% NA
Japonica Intermediate  241 88.80% 7.10% 2.07% 2.07% NA
VI/Aromatic  96 100.00% 0.00% 0.00% 0.00% NA
Intermediate  90 82.20% 12.20% 0.00% 5.56% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1125230308 C -> DEL N N silent_mutation Average:42.493; most accessible tissue: Callus, score: 79.572 N N N N
vg1125230308 C -> G LOC_Os11g41960.1 upstream_gene_variant ; 1984.0bp to feature; MODIFIER silent_mutation Average:42.493; most accessible tissue: Callus, score: 79.572 N N N N
vg1125230308 C -> G LOC_Os11g41940.1 downstream_gene_variant ; 2982.0bp to feature; MODIFIER silent_mutation Average:42.493; most accessible tissue: Callus, score: 79.572 N N N N
vg1125230308 C -> G LOC_Os11g41950.1 downstream_gene_variant ; 61.0bp to feature; MODIFIER silent_mutation Average:42.493; most accessible tissue: Callus, score: 79.572 N N N N
vg1125230308 C -> G LOC_Os11g41970.1 downstream_gene_variant ; 4514.0bp to feature; MODIFIER silent_mutation Average:42.493; most accessible tissue: Callus, score: 79.572 N N N N
vg1125230308 C -> G LOC_Os11g41940-LOC_Os11g41950 intergenic_region ; MODIFIER silent_mutation Average:42.493; most accessible tissue: Callus, score: 79.572 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1125230308 NA 5.32E-06 mr1388 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125230308 NA 1.36E-07 mr1583 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125230308 1.57E-11 5.20E-12 mr1662 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125230308 NA 2.20E-06 mr1662 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125230308 NA 6.17E-06 mr1925 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125230308 6.42E-09 1.74E-10 mr1662_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125230308 6.95E-08 1.72E-07 mr1662_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251