\
| Variant ID: vg1125230308 (JBrowse) | Variation Type: SNP |
| Chromosome: chr11 | Position: 25230308 |
| Reference Allele: C | Alternative Allele: G |
| Primary Allele: C | Secondary Allele: G |
Inferred Ancestral Allele: Not determined.
AATTTAAACTTCGCTGAAACAATTTGGTACCGTGAGGTACGGTATCTCGAGATACTTTTTGATGTACTGGGGCATATCTCTTCCCTACACTAACTAATGC[C/G]
AACACATCATGATTAATCATCATATCTTTCTAACGCTTCCTCCTCCTGACAGGTTCTTCTTCACGGCGACTCCATTGCGGAACCTTCTCCGGCTAGGGGA
TCCCCTAGCCGGAGAAGGTTCCGCAATGGAGTCGCCGTGAAGAAGAACCTGTCAGGAGGAGGAAGCGTTAGAAAGATATGATGATTAATCATGATGTGTT[G/C]
GCATTAGTTAGTGTAGGGAAGAGATATGCCCCAGTACATCAAAAAGTATCTCGAGATACCGTACCTCACGGTACCAAATTGTTTCAGCGAAGTTTAAATT
| Populations | Population Size | Frequency of C(primary allele) | Frequency of G(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 88.00% | 9.30% | 0.66% | 2.07% | NA |
| All Indica | 2759 | 86.40% | 12.20% | 0.33% | 1.09% | NA |
| All Japonica | 1512 | 88.70% | 5.70% | 1.46% | 4.17% | NA |
| Aus | 269 | 98.10% | 1.90% | 0.00% | 0.00% | NA |
| Indica I | 595 | 93.10% | 6.70% | 0.17% | 0.00% | NA |
| Indica II | 465 | 98.50% | 0.20% | 0.22% | 1.08% | NA |
| Indica III | 913 | 78.40% | 19.80% | 0.22% | 1.53% | NA |
| Indica Intermediate | 786 | 83.50% | 14.50% | 0.64% | 1.40% | NA |
| Temperate Japonica | 767 | 99.20% | 0.70% | 0.13% | 0.00% | NA |
| Tropical Japonica | 504 | 72.60% | 12.70% | 3.17% | 11.51% | NA |
| Japonica Intermediate | 241 | 88.80% | 7.10% | 2.07% | 2.07% | NA |
| VI/Aromatic | 96 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 82.20% | 12.20% | 0.00% | 5.56% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1125230308 | C -> DEL | N | N | silent_mutation | Average:42.493; most accessible tissue: Callus, score: 79.572 | N | N | N | N |
| vg1125230308 | C -> G | LOC_Os11g41960.1 | upstream_gene_variant ; 1984.0bp to feature; MODIFIER | silent_mutation | Average:42.493; most accessible tissue: Callus, score: 79.572 | N | N | N | N |
| vg1125230308 | C -> G | LOC_Os11g41940.1 | downstream_gene_variant ; 2982.0bp to feature; MODIFIER | silent_mutation | Average:42.493; most accessible tissue: Callus, score: 79.572 | N | N | N | N |
| vg1125230308 | C -> G | LOC_Os11g41950.1 | downstream_gene_variant ; 61.0bp to feature; MODIFIER | silent_mutation | Average:42.493; most accessible tissue: Callus, score: 79.572 | N | N | N | N |
| vg1125230308 | C -> G | LOC_Os11g41970.1 | downstream_gene_variant ; 4514.0bp to feature; MODIFIER | silent_mutation | Average:42.493; most accessible tissue: Callus, score: 79.572 | N | N | N | N |
| vg1125230308 | C -> G | LOC_Os11g41940-LOC_Os11g41950 | intergenic_region ; MODIFIER | silent_mutation | Average:42.493; most accessible tissue: Callus, score: 79.572 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1125230308 | NA | 5.32E-06 | mr1388 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1125230308 | NA | 1.36E-07 | mr1583 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1125230308 | 1.57E-11 | 5.20E-12 | mr1662 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1125230308 | NA | 2.20E-06 | mr1662 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1125230308 | NA | 6.17E-06 | mr1925 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1125230308 | 6.42E-09 | 1.74E-10 | mr1662_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1125230308 | 6.95E-08 | 1.72E-07 | mr1662_2 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |