Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923).

Detailed information for vg1125230308:

Variant ID: vg1125230308 (JBrowse)	Variation Type: SNP
Chromosome: chr11	Position: 25230308
Reference Allele: C	Alternative Allele: G
Primary Allele: C	Secondary Allele: G

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

AATTTAAACTTCGCTGAAACAATTTGGTACCGTGAGGTACGGTATCTCGAGATACTTTTTGATGTACTGGGGCATATCTCTTCCCTACACTAACTAATGC[C/G]
AACACATCATGATTAATCATCATATCTTTCTAACGCTTCCTCCTCCTGACAGGTTCTTCTTCACGGCGACTCCATTGCGGAACCTTCTCCGGCTAGGGGA

Reverse complement sequence

TCCCCTAGCCGGAGAAGGTTCCGCAATGGAGTCGCCGTGAAGAAGAACCTGTCAGGAGGAGGAAGCGTTAGAAAGATATGATGATTAATCATGATGTGTT[G/C]
GCATTAGTTAGTGTAGGGAAGAGATATGCCCCAGTACATCAAAAAGTATCTCGAGATACCGTACCTCACGGTACCAAATTGTTTCAGCGAAGTTTAAATT

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of G(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	88.00%	9.30%	0.66%	2.07%	NA
All Indica	2759	86.40%	12.20%	0.33%	1.09%	NA
All Japonica	1512	88.70%	5.70%	1.46%	4.17%	NA
Aus	269	98.10%	1.90%	0.00%	0.00%	NA
Indica I	595	93.10%	6.70%	0.17%	0.00%	NA
Indica II	465	98.50%	0.20%	0.22%	1.08%	NA
Indica III	913	78.40%	19.80%	0.22%	1.53%	NA
Indica Intermediate	786	83.50%	14.50%	0.64%	1.40%	NA
Temperate Japonica	767	99.20%	0.70%	0.13%	0.00%	NA
Tropical Japonica	504	72.60%	12.70%	3.17%	11.51%	NA
Japonica Intermediate	241	88.80%	7.10%	2.07%	2.07%	NA
VI/Aromatic	96	100.00%	0.00%	0.00%	0.00%	NA
Intermediate	90	82.20%	12.20%	0.00%	5.56%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1125230308	C -> DEL	N	N	silent_mutation	Average:42.493; most accessible tissue: Callus, score: 79.572	N	N	N	N
vg1125230308	C -> G	LOC_Os11g41960.1	upstream_gene_variant ; 1984.0bp to feature; MODIFIER	silent_mutation	Average:42.493; most accessible tissue: Callus, score: 79.572	N	N	N	N
vg1125230308	C -> G	LOC_Os11g41940.1	downstream_gene_variant ; 2982.0bp to feature; MODIFIER	silent_mutation	Average:42.493; most accessible tissue: Callus, score: 79.572	N	N	N	N
vg1125230308	C -> G	LOC_Os11g41950.1	downstream_gene_variant ; 61.0bp to feature; MODIFIER	silent_mutation	Average:42.493; most accessible tissue: Callus, score: 79.572	N	N	N	N
vg1125230308	C -> G	LOC_Os11g41970.1	downstream_gene_variant ; 4514.0bp to feature; MODIFIER	silent_mutation	Average:42.493; most accessible tissue: Callus, score: 79.572	N	N	N	N
vg1125230308	C -> G	LOC_Os11g41940-LOC_Os11g41950	intergenic_region ; MODIFIER	silent_mutation	Average:42.493; most accessible tissue: Callus, score: 79.572	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1125230308	NA	5.32E-06	mr1388	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125230308	NA	1.36E-07	mr1583	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125230308	1.57E-11	5.20E-12	mr1662	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125230308	NA	2.20E-06	mr1662	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125230308	NA	6.17E-06	mr1925	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125230308	6.42E-09	1.74E-10	mr1662_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125230308	6.95E-08	1.72E-07	mr1662_2	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251