\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1125228741:

Variant ID: vg1125228741 (JBrowse)Variation Type: SNP
Chromosome: chr11Position: 25228741
Reference Allele: GAlternative Allele: A
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.97, A: 0.03, others allele: 0.00, population size: 116. )

Flanking Sequence (100 bp) in Reference Genome:


TCAACCCAACTGCGTGAACTAAACTTAATTTGAGCGCGTCAGATATCAAGCTCCTACTTGATATCGAGCCGGTTAGCGGCAAGGCGTTGGCGTGGTGGCC[G/A]
CGCGTTGAAGGTGTACAGTTAGTGGTGGCCACTGTTTTCAGAATGCAACGGCAACACGAGAAGGCAGATTACAGGCACAAGTCCAACCTTGTTGGGCCAG

Reverse complement sequence

CTGGCCCAACAAGGTTGGACTTGTGCCTGTAATCTGCCTTCTCGTGTTGCCGTTGCATTCTGAAAACAGTGGCCACCACTAACTGTACACCTTCAACGCG[C/T]
GGCCACCACGCCAACGCCTTGCCGCTAACCGGCTCGATATCAAGTAGGAGCTTGATATCTGACGCGCTCAAATTAAGTTTAGTTCACGCAGTTGGGTTGA

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 93.70% 6.20% 0.02% 0.00% NA
All Indica  2759 91.20% 8.80% 0.00% 0.00% NA
All Japonica  1512 99.90% 0.10% 0.07% 0.00% NA
Aus  269 84.00% 16.00% 0.00% 0.00% NA
Indica I  595 99.30% 0.70% 0.00% 0.00% NA
Indica II  465 84.10% 15.90% 0.00% 0.00% NA
Indica III  913 94.10% 5.90% 0.00% 0.00% NA
Indica Intermediate  786 85.90% 14.10% 0.00% 0.00% NA
Temperate Japonica  767 100.00% 0.00% 0.00% 0.00% NA
Tropical Japonica  504 99.60% 0.20% 0.20% 0.00% NA
Japonica Intermediate  241 100.00% 0.00% 0.00% 0.00% NA
VI/Aromatic  96 100.00% 0.00% 0.00% 0.00% NA
Intermediate  90 91.10% 8.90% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1125228741 G -> A LOC_Os11g41960.1 upstream_gene_variant ; 3551.0bp to feature; MODIFIER silent_mutation Average:69.355; most accessible tissue: Zhenshan97 flower, score: 88.302 N N N N
vg1125228741 G -> A LOC_Os11g41940.1 downstream_gene_variant ; 1415.0bp to feature; MODIFIER silent_mutation Average:69.355; most accessible tissue: Zhenshan97 flower, score: 88.302 N N N N
vg1125228741 G -> A LOC_Os11g41950.1 downstream_gene_variant ; 1628.0bp to feature; MODIFIER silent_mutation Average:69.355; most accessible tissue: Zhenshan97 flower, score: 88.302 N N N N
vg1125228741 G -> A LOC_Os11g41940-LOC_Os11g41950 intergenic_region ; MODIFIER silent_mutation Average:69.355; most accessible tissue: Zhenshan97 flower, score: 88.302 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg1125228741 G A 0.36 0.31 0.15 0.06 0.26 0.3

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1125228741 NA 3.36E-08 mr1291 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125228741 NA 7.68E-06 mr1291 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125228741 6.12E-06 3.55E-06 mr1553 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125228741 NA 2.48E-06 mr1609 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125228741 NA 1.21E-06 mr1815 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125228741 5.96E-07 1.25E-09 mr1892 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125228741 NA 1.27E-06 mr1892 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125228741 NA 8.12E-06 mr1609_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125228741 NA 6.71E-06 mr1795_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251