\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1125227929:

Variant ID: vg1125227929 (JBrowse)Variation Type: SNP
Chromosome: chr11Position: 25227929
Reference Allele: GAlternative Allele: A
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


GATTACTGTAGGCATTCTTGATTGGTCCATAGGTTAAAGTTATGTACTCCCTCTGTTTCAAAATATTTGACACCGTTGACTTTTTAGCACGTGTTTGACT[G/A]
TTCGTCTTATTAAAAAAAATCATGAAATATGTAAAACTATATGTGTACATGAAAGTATATTTAACAATGAATCAAATGATATGAAAAGAATAAATAATTA

Reverse complement sequence

TAATTATTTATTCTTTTCATATCATTTGATTCATTGTTAAATATACTTTCATGTACACATATAGTTTTACATATTTCATGATTTTTTTTAATAAGACGAA[C/T]
AGTCAAACACGTGCTAAAAAGTCAACGGTGTCAAATATTTTGAAACAGAGGGAGTACATAACTTTAACCTATGGACCAATCAAGAATGCCTACAGTAATC

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 84.60% 8.80% 3.77% 2.75% NA
All Indica  2759 78.30% 13.00% 4.82% 3.91% NA
All Japonica  1512 95.80% 0.50% 2.58% 1.12% NA
Aus  269 92.20% 6.70% 0.37% 0.74% NA
Indica I  595 60.20% 32.60% 5.38% 1.85% NA
Indica II  465 80.00% 19.80% 0.22% 0.00% NA
Indica III  913 86.10% 1.20% 5.81% 6.90% NA
Indica Intermediate  786 81.90% 7.80% 5.98% 4.33% NA
Temperate Japonica  767 98.40% 0.90% 0.26% 0.39% NA
Tropical Japonica  504 91.70% 0.00% 5.95% 2.38% NA
Japonica Intermediate  241 95.90% 0.40% 2.90% 0.83% NA
VI/Aromatic  96 78.10% 20.80% 1.04% 0.00% NA
Intermediate  90 76.70% 15.60% 4.44% 3.33% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1125227929 G -> A LOC_Os11g41960.1 upstream_gene_variant ; 4363.0bp to feature; MODIFIER silent_mutation Average:34.95; most accessible tissue: Callus, score: 71.037 N N N N
vg1125227929 G -> A LOC_Os11g41940.1 downstream_gene_variant ; 603.0bp to feature; MODIFIER silent_mutation Average:34.95; most accessible tissue: Callus, score: 71.037 N N N N
vg1125227929 G -> A LOC_Os11g41950.1 downstream_gene_variant ; 2440.0bp to feature; MODIFIER silent_mutation Average:34.95; most accessible tissue: Callus, score: 71.037 N N N N
vg1125227929 G -> A LOC_Os11g41940-LOC_Os11g41950 intergenic_region ; MODIFIER silent_mutation Average:34.95; most accessible tissue: Callus, score: 71.037 N N N N
vg1125227929 G -> DEL N N silent_mutation Average:34.95; most accessible tissue: Callus, score: 71.037 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1125227929 4.79E-18 7.65E-31 mr1191 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125227929 5.47E-16 6.94E-21 mr1191 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125227929 NA 9.62E-06 mr1530 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125227929 9.77E-22 4.79E-35 mr1644 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125227929 1.33E-17 3.14E-23 mr1644 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125227929 1.14E-08 2.09E-12 mr1662 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125227929 1.46E-09 2.33E-13 mr1662 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125227929 NA 3.71E-07 mr1745 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125227929 1.73E-22 1.64E-49 mr1191_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125227929 1.21E-17 2.32E-34 mr1191_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125227929 NA 9.88E-06 mr1380_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125227929 4.09E-08 8.83E-15 mr1662_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125227929 1.68E-09 3.30E-15 mr1662_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125227929 NA 1.41E-08 mr1745_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125227929 NA 2.52E-06 mr1875_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125227929 NA 1.68E-06 mr1908_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251