Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1125227929:

Variant ID: vg1125227929 (JBrowse)	Variation Type: SNP
Chromosome: chr11	Position: 25227929
Reference Allele: G	Alternative Allele: A
Primary Allele: G	Secondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

GATTACTGTAGGCATTCTTGATTGGTCCATAGGTTAAAGTTATGTACTCCCTCTGTTTCAAAATATTTGACACCGTTGACTTTTTAGCACGTGTTTGACT[G/A]
TTCGTCTTATTAAAAAAAATCATGAAATATGTAAAACTATATGTGTACATGAAAGTATATTTAACAATGAATCAAATGATATGAAAAGAATAAATAATTA

Reverse complement sequence

TAATTATTTATTCTTTTCATATCATTTGATTCATTGTTAAATATACTTTCATGTACACATATAGTTTTACATATTTCATGATTTTTTTTAATAAGACGAA[C/T]
AGTCAAACACGTGCTAAAAAGTCAACGGTGTCAAATATTTTGAAACAGAGGGAGTACATAACTTTAACCTATGGACCAATCAAGAATGCCTACAGTAATC

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	84.60%	8.80%	3.77%	2.75%	NA
All Indica	2759	78.30%	13.00%	4.82%	3.91%	NA
All Japonica	1512	95.80%	0.50%	2.58%	1.12%	NA
Aus	269	92.20%	6.70%	0.37%	0.74%	NA
Indica I	595	60.20%	32.60%	5.38%	1.85%	NA
Indica II	465	80.00%	19.80%	0.22%	0.00%	NA
Indica III	913	86.10%	1.20%	5.81%	6.90%	NA
Indica Intermediate	786	81.90%	7.80%	5.98%	4.33%	NA
Temperate Japonica	767	98.40%	0.90%	0.26%	0.39%	NA
Tropical Japonica	504	91.70%	0.00%	5.95%	2.38%	NA
Japonica Intermediate	241	95.90%	0.40%	2.90%	0.83%	NA
VI/Aromatic	96	78.10%	20.80%	1.04%	0.00%	NA
Intermediate	90	76.70%	15.60%	4.44%	3.33%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1125227929	G -> A	LOC_Os11g41960.1	upstream_gene_variant ; 4363.0bp to feature; MODIFIER	silent_mutation	Average:34.95; most accessible tissue: Callus, score: 71.037	N	N	N	N
vg1125227929	G -> A	LOC_Os11g41940.1	downstream_gene_variant ; 603.0bp to feature; MODIFIER	silent_mutation	Average:34.95; most accessible tissue: Callus, score: 71.037	N	N	N	N
vg1125227929	G -> A	LOC_Os11g41950.1	downstream_gene_variant ; 2440.0bp to feature; MODIFIER	silent_mutation	Average:34.95; most accessible tissue: Callus, score: 71.037	N	N	N	N
vg1125227929	G -> A	LOC_Os11g41940-LOC_Os11g41950	intergenic_region ; MODIFIER	silent_mutation	Average:34.95; most accessible tissue: Callus, score: 71.037	N	N	N	N
vg1125227929	G -> DEL	N	N	silent_mutation	Average:34.95; most accessible tissue: Callus, score: 71.037	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1125227929	4.79E-18	7.65E-31	mr1191	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125227929	5.47E-16	6.94E-21	mr1191	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125227929	NA	9.62E-06	mr1530	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125227929	9.77E-22	4.79E-35	mr1644	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125227929	1.33E-17	3.14E-23	mr1644	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125227929	1.14E-08	2.09E-12	mr1662	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125227929	1.46E-09	2.33E-13	mr1662	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125227929	NA	3.71E-07	mr1745	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125227929	1.73E-22	1.64E-49	mr1191_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125227929	1.21E-17	2.32E-34	mr1191_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125227929	NA	9.88E-06	mr1380_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125227929	4.09E-08	8.83E-15	mr1662_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125227929	1.68E-09	3.30E-15	mr1662_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125227929	NA	1.41E-08	mr1745_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125227929	NA	2.52E-06	mr1875_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125227929	NA	1.68E-06	mr1908_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251