\
| Variant ID: vg1125224256 (JBrowse) | Variation Type: SNP |
| Chromosome: chr11 | Position: 25224256 |
| Reference Allele: G | Alternative Allele: A |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 1.00, A: 0.00, others allele: 0.00, population size: 218. )
ATGTGCTTCCTGCTCCCACCTCATCGCCTCAGGATGCAGCTAGTTTAGGCTGTGCTTAGTTCCTCGGTCAAAAATTTTTTAAGTACACAAACACACATTT[G/A]
AAATATTAAACGTAGACTAATAACAAAACAAATTATAGATTCCGTATGTAAACTGCGAGATGAATTTATTAAGTCTAATTAATTTATCATTAGCGAATGT
ACATTCGCTAATGATAAATTAATTAGACTTAATAAATTCATCTCGCAGTTTACATACGGAATCTATAATTTGTTTTGTTATTAGTCTACGTTTAATATTT[C/T]
AAATGTGTGTTTGTGTACTTAAAAAATTTTTGACCGAGGAACTAAGCACAGCCTAAACTAGCTGCATCCTGAGGCGATGAGGTGGGAGCAGGAAGCACAT
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 68.00% | 31.70% | 0.25% | 0.00% | NA |
| All Indica | 2759 | 54.90% | 44.80% | 0.33% | 0.00% | NA |
| All Japonica | 1512 | 87.40% | 12.50% | 0.13% | 0.00% | NA |
| Aus | 269 | 79.90% | 19.70% | 0.37% | 0.00% | NA |
| Indica I | 595 | 40.30% | 58.80% | 0.84% | 0.00% | NA |
| Indica II | 465 | 93.80% | 6.00% | 0.22% | 0.00% | NA |
| Indica III | 913 | 44.50% | 55.40% | 0.11% | 0.00% | NA |
| Indica Intermediate | 786 | 55.00% | 44.80% | 0.25% | 0.00% | NA |
| Temperate Japonica | 767 | 97.70% | 2.20% | 0.13% | 0.00% | NA |
| Tropical Japonica | 504 | 71.80% | 28.20% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 87.10% | 12.40% | 0.41% | 0.00% | NA |
| VI/Aromatic | 96 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 75.60% | 24.40% | 0.00% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1125224256 | G -> A | LOC_Os11g41940.1 | upstream_gene_variant ; 1412.0bp to feature; MODIFIER | silent_mutation | Average:45.416; most accessible tissue: Zhenshan97 panicle, score: 65.386 | N | N | N | N |
| vg1125224256 | G -> A | LOC_Os11g41920.1 | downstream_gene_variant ; 1899.0bp to feature; MODIFIER | silent_mutation | Average:45.416; most accessible tissue: Zhenshan97 panicle, score: 65.386 | N | N | N | N |
| vg1125224256 | G -> A | LOC_Os11g41920-LOC_Os11g41940 | intergenic_region ; MODIFIER | silent_mutation | Average:45.416; most accessible tissue: Zhenshan97 panicle, score: 65.386 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1125224256 | NA | 3.14E-06 | mr1159 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1125224256 | 1.09E-09 | NA | mr1191 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1125224256 | 1.18E-08 | 1.26E-07 | mr1191 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1125224256 | NA | 1.65E-06 | mr1441 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1125224256 | NA | 3.02E-07 | mr1583 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1125224256 | 9.97E-11 | NA | mr1644 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1125224256 | 7.43E-10 | 4.65E-08 | mr1644 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1125224256 | 4.40E-06 | NA | mr1662 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1125224256 | 1.15E-07 | 3.28E-08 | mr1794 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1125224256 | NA | 8.74E-06 | mr1150_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1125224256 | NA | 3.01E-06 | mr1159_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1125224256 | 2.55E-10 | NA | mr1191_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1125224256 | 7.89E-09 | 2.05E-08 | mr1191_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1125224256 | NA | 5.41E-07 | mr1218_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1125224256 | NA | 2.61E-08 | mr1850_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1125224256 | NA | 6.92E-06 | mr1895_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1125224256 | NA | 6.48E-08 | mr1933_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |