\
| Variant ID: vg1125199412 (JBrowse) | Variation Type: SNP |
| Chromosome: chr11 | Position: 25199412 |
| Reference Allele: C | Alternative Allele: T |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 1.00, others allele: 0.00, population size: 123. )
AGGGCCAAGCAAGTAATCATTTTCATGTCTCGATCCCAATGCCTTTATGATTCTACTCTGGTTCCATAATTCGTGACGTTTTAGACATTGACACAGTCTC[C/T]
AAAATATATCTGACTATGTTTTTCTATTATAATATATGCAATAAATAATTTTTCATTTTATTATAATACTTAGTAAAACGAATCTATATACGTTGTTCTA
TAGAACAACGTATATAGATTCGTTTTACTAAGTATTATAATAAAATGAAAAATTATTTATTGCATATATTATAATAGAAAAACATAGTCAGATATATTTT[G/A]
GAGACTGTGTCAATGTCTAAAACGTCACGAATTATGGAACCAGAGTAGAATCATAAAGGCATTGGGATCGAGACATGAAAATGATTACTTGCTTGGCCCT
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 95.20% | 4.80% | 0.04% | 0.00% | NA |
| All Indica | 2759 | 92.00% | 8.00% | 0.07% | 0.00% | NA |
| All Japonica | 1512 | 99.90% | 0.10% | 0.00% | 0.00% | NA |
| Aus | 269 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica I | 595 | 99.30% | 0.70% | 0.00% | 0.00% | NA |
| Indica II | 465 | 84.50% | 15.50% | 0.00% | 0.00% | NA |
| Indica III | 913 | 95.30% | 4.60% | 0.11% | 0.00% | NA |
| Indica Intermediate | 786 | 86.90% | 13.00% | 0.13% | 0.00% | NA |
| Temperate Japonica | 767 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 99.80% | 0.20% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 95.60% | 4.40% | 0.00% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1125199412 | C -> T | LOC_Os11g41890.1 | downstream_gene_variant ; 2064.0bp to feature; MODIFIER | silent_mutation | Average:49.978; most accessible tissue: Zhenshan97 flower, score: 81.724 | N | N | N | N |
| vg1125199412 | C -> T | LOC_Os11g41900.1 | downstream_gene_variant ; 419.0bp to feature; MODIFIER | silent_mutation | Average:49.978; most accessible tissue: Zhenshan97 flower, score: 81.724 | N | N | N | N |
| vg1125199412 | C -> T | LOC_Os11g41890-LOC_Os11g41900 | intergenic_region ; MODIFIER | silent_mutation | Average:49.978; most accessible tissue: Zhenshan97 flower, score: 81.724 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1125199412 | NA | 2.20E-06 | mr1291 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1125199412 | NA | 7.49E-06 | mr1291 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1125199412 | NA | 8.31E-06 | mr1543 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1125199412 | 6.61E-06 | NA | mr1553 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1125199412 | 7.16E-06 | 4.84E-06 | mr1553 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1125199412 | NA | 5.14E-07 | mr1892 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1125199412 | NA | 2.37E-06 | mr1892 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |