\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1125199412:

Variant ID: vg1125199412 (JBrowse)Variation Type: SNP
Chromosome: chr11Position: 25199412
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 1.00, others allele: 0.00, population size: 123. )

Flanking Sequence (100 bp) in Reference Genome:


AGGGCCAAGCAAGTAATCATTTTCATGTCTCGATCCCAATGCCTTTATGATTCTACTCTGGTTCCATAATTCGTGACGTTTTAGACATTGACACAGTCTC[C/T]
AAAATATATCTGACTATGTTTTTCTATTATAATATATGCAATAAATAATTTTTCATTTTATTATAATACTTAGTAAAACGAATCTATATACGTTGTTCTA

Reverse complement sequence

TAGAACAACGTATATAGATTCGTTTTACTAAGTATTATAATAAAATGAAAAATTATTTATTGCATATATTATAATAGAAAAACATAGTCAGATATATTTT[G/A]
GAGACTGTGTCAATGTCTAAAACGTCACGAATTATGGAACCAGAGTAGAATCATAAAGGCATTGGGATCGAGACATGAAAATGATTACTTGCTTGGCCCT

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 95.20% 4.80% 0.04% 0.00% NA
All Indica  2759 92.00% 8.00% 0.07% 0.00% NA
All Japonica  1512 99.90% 0.10% 0.00% 0.00% NA
Aus  269 100.00% 0.00% 0.00% 0.00% NA
Indica I  595 99.30% 0.70% 0.00% 0.00% NA
Indica II  465 84.50% 15.50% 0.00% 0.00% NA
Indica III  913 95.30% 4.60% 0.11% 0.00% NA
Indica Intermediate  786 86.90% 13.00% 0.13% 0.00% NA
Temperate Japonica  767 100.00% 0.00% 0.00% 0.00% NA
Tropical Japonica  504 99.80% 0.20% 0.00% 0.00% NA
Japonica Intermediate  241 100.00% 0.00% 0.00% 0.00% NA
VI/Aromatic  96 100.00% 0.00% 0.00% 0.00% NA
Intermediate  90 95.60% 4.40% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1125199412 C -> T LOC_Os11g41890.1 downstream_gene_variant ; 2064.0bp to feature; MODIFIER silent_mutation Average:49.978; most accessible tissue: Zhenshan97 flower, score: 81.724 N N N N
vg1125199412 C -> T LOC_Os11g41900.1 downstream_gene_variant ; 419.0bp to feature; MODIFIER silent_mutation Average:49.978; most accessible tissue: Zhenshan97 flower, score: 81.724 N N N N
vg1125199412 C -> T LOC_Os11g41890-LOC_Os11g41900 intergenic_region ; MODIFIER silent_mutation Average:49.978; most accessible tissue: Zhenshan97 flower, score: 81.724 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1125199412 NA 2.20E-06 mr1291 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125199412 NA 7.49E-06 mr1291 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125199412 NA 8.31E-06 mr1543 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125199412 6.61E-06 NA mr1553 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125199412 7.16E-06 4.84E-06 mr1553 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125199412 NA 5.14E-07 mr1892 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125199412 NA 2.37E-06 mr1892 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251